Basic Search | Intermediate Search | Advanced SQL Search | Gene Image Map |  Home

Ureaplasma urealyticum

 Gene Flanking Sequence Viewer
This view is based on a particular gene which is displayed with some associated information above the sequence. You may add on "Flanking sequence" either upstream (Start Flank Size) or downstream (Stop Flank Size). You may specify the number of sequence characters per line and choose whether or not you want coordinates displayed to the right, left, or both left and right of the sequence. The sequence displayed is the sense strand relative to the gene the viewer is displaying. In reading the coordinates, note that there is no zero coordinate and that the genomic sequence is assumed to be circular.
Start Flank Size:
Stop Flank Size:
Characters per line:
Show Coordinates on: Left: Right:


Gene ID:UU494
Strand:Forward
Gene Start: 591955
Gene Stop: 593880
Gene Length:   1926

591955  ATGTCAAAAATAACTAACAATGTTTTTTTAACAATTCGTAATGCTATAAA  592004
592005  TATTTCCGATGTTATTCAAAATTACATTAAAGTAATTAAAAAGGGTAATA  592054
592055  ATTATTGAGCTATTTGTCCATTTCACAATGATACAAATGAATCATTGTCA  592104
592105  ATCAATGATAAAAAACAAATCTTTAAATGTTTTGCTTGTAATCATGCTGG  592154
592155  TGATGTGATTAAATTTGTTGCTGAATATAAAAAGATCTCCTATGCTTTAG  592204
592205  CAGCACAAGAGATTGTTCAATTAATGAATTTAGATTTAAACTTATTGAAT  592254
592255  CATTTACAAAAAATTTCTCCACAAGAAATTAAAAAAAATAAGGTTTTTGA  592304
592305  TTTAAACAAACAAATTCAAAAATGATTTATTAATTTTTTAAATAATAAAA  592354
592355  ATAACATTCATGTTATTGATTATTTAACTAAACGAAATTTAAATAAAAAT  592404
592405  GATTTAGCATATTTTAAAATCGGTTATGCTCCAAATAATGATGAATTATT  592454
592455  AAATTTAATAAAATCTAATTATAATAATCTGATACAAGAAAATGACGAGT  592504
592505  TTGAATTAAATAAATTAATAGAAAATTCCTTTTTAGTAATTGATAAGAAT  592554
592555  GGTAATTACCATGATTTTTTTAATGATCGTATTATTTTTAGTATTTATGA  592604
592605  TCATCTCAATAACGTTGTTGGTTTTAGCGGACGTATAATTACAAATGAGA  592654
592655  AAACACCAAAATATTTAAATACTAAAACCACTGCTGTATTTAAAAAAGAT  592704
592705  GAAGTTCTTTATAATTTTCATAATGTTATCACCATTGAAAATAATCATCA  592754
592755  ATTATTTATAGTTGAAGGTTTTATGGATGTTATTACAATTCATAAATCTA  592804
592805  ACAAACCAAACGTTGTAGCAACAATGGGTGTTGAATTAACTAATAAACAT  592854
592855  TTAGAATTAATTAAAAGCTATGGAATTAAAGATTTAATTTTATGTTTTGA  592904
592905  TAACGATCAAGCAGGTTTTTTAGCTACTAAAAAACAAATTATGAAATTAA  592954
592955  TTAATTCCCCATTCAACATTTTTATTGTTAATCATAAAGATAATGATTGC  593004
593005  AAAGACATGGATGAATATGCAAATAAGCACGGTTATAGTGCAACAAGTAA  593054
593055  GCTATTAGACCAACAACTTCATATTAGTGAATTTTTATTATTAGAAATTA  593104
593105  GTAATACAAACAAATCTACCCCCTCACTAAAACACAGTTATAAACAAGAG  593154
593155  TGTTTTACAATCATTAAAAAATATGGTGATATTTTTTATGTAGATAAATA  593204
593205  TGTTGATTTCATGAAACAAACATTTTCAATTGAAGAAAATTTATTAAAAA  593254
593255  AAGTTATTGAAGAATTATTAATTAACAAACAATGTAATTCTATTCAAAAC  593304
593305  AAAAAGAACATTCAATCATATCAAAAACAAACACAACTAACTAATAAACT  593354
593355  TACTACTTCAAACCCAAAAGTTATCCTAACAAAAATTGATAAACATTTTA  593404
593405  ACCACTTAGTAGTAATTATATTAATGAATCGGGTTTTCTTAAACCGTCTT  593454
593455  GATACGCAAGTTCGTAACCGGTTAACTAAAGAGCAAAGTTTAGTGATTAA  593504
593505  TATTATAGAAGACTTTTATTTGTACCATTTTAAGATTAATAATATTTTAA  593554
593555  AAAACACTGATTCTTTTATTGAATTTATTAATAAAAACTACAGTAAATAT  593604
593605  ACTAATGTTATTAACCAACTTACAAAAATGGTGCAGATTATTAAATATAA  593654
593655  CCCTAAGTTTGATAATATAGTGGCATTTGAACTAGCTAAAAATAATTTTA  593704
593705  TATATGAATGATTAAACAACCAAATTAAACGTTTAAAACTCATCAATCTA  593754
593755  AATTTAAATATGAATAATAACCAAGAACAAATCATAAATAATGAAAAATT  593804
593805  AATAAAGCAATATAATGATGAAAAAATTTTATTAGACAATTTAATCAATG  593854
593855  CTTCTTTATTTCATAAAAATCAATAA                          593880

Los Alamos National Laboratory     
Operated by the University of California for the National Nuclear Security Administration,
of the US Department of Energy.     Copyright © 2001 UC | Disclaimer/Privacy