Basic Search | Intermediate Search | Advanced SQL Search | Gene Image Map |  Home

Ureaplasma urealyticum

 Gene Flanking Sequence Viewer
This view is based on a particular gene which is displayed with some associated information above the sequence. You may add on "Flanking sequence" either upstream (Start Flank Size) or downstream (Stop Flank Size). You may specify the number of sequence characters per line and choose whether or not you want coordinates displayed to the right, left, or both left and right of the sequence. The sequence displayed is the sense strand relative to the gene the viewer is displaying. In reading the coordinates, note that there is no zero coordinate and that the genomic sequence is assumed to be circular.
Start Flank Size:
Stop Flank Size:
Characters per line:
Show Coordinates on: Left: Right:


Gene ID:UU285
Strand:Forward
Gene Start: 321667
Gene Stop: 322929
Gene Length:   1263

321667  ATGATTAATTACAGTAAACCACGAGGTACTATAGATTTATATAATAAAGA  321716
321717  AATGAATGATTTTAAATTACTTGAAAATTTTTTATTATCAACTACTAAAA  321766
321767  GATATGGCTTTCAGCAAATTAAAACACCTGTTTTTGAATTTGCAGAACTC  321816
321817  TTTATGAAATCAGCTGGTGAAAGTTCAGATTTAGTTTCAAAAGAAATGTA  321866
321867  TTTATTTAAAGATAAATCAGATCGCTGACTAGCGTTAAGACCTGAAGGAA  321916
321917  CAGCAGGTGTTATTCGTGCTGTTGTTGAGAATAAATTACTATTAAATCAT  321966
321967  CCACTACCATTAAAATTAATGTATTTTGAGCCTTGTTTTCGTTATGAACG  322016
322017  CCCTCAAGCTGGACGTCAACGCCAATTTCATCAATTTGGTGTTGAAGTGT  322066
322067  TGGGAACAAAAAATATTTATTATGATTTTGAATTAATTGCTTTAGCTGAT  322116
322117  ACAATTTTAAAAAAATTAATGATATCTAATTATATTTTAGAAATTAATTA  322166
322167  TATCTCATCTCCTCATAATCGTTCATTATGAGTTAAAAGTTTGCAAGAAT  322216
322217  ATTTTCATTTACATCGTACTGAATTAACTCCATTAAGTCAAGAACGTATT  322266
322267  ACAACCAATCCTTTGCGTATTTTAGATGATAAATTAGAATCTCAAAAACT  322316
322317  AGTTGTAAAACAAGCTCCAAAAATTAGTCATTTTTTATCAAATGAAGAAA  322366
322367  AAGAAGAATTTAATCTAATTAAAAAAATGCTTGATGATTATAACATTAAA  322416
322417  TATTATGTTAACGAAGGATTAGTAAGAGGTTTGGATTATTATAGTGGATT  322466
322467  AGTATTTGAATTTATTTCAACTTCACCTAAATTATTAGGTCAATCAACAA  322516
322517  TTATAGGTGGAGGCCGATATGGTGAATTAATTAAACAAACAGGTGGCCCT  322566
322567  AATTATGAAGGTATTGGTTTTGGTATAGGAATTGAACGTTTATTAATAGC  322616
322617  TTTATCTGAAACCAATAAAAATATTTTAAACACTGATGATGATAAATATT  322666
322667  TAATTGCATTTTTTGATAAAGAATTAGAGAATGAAGCTATAAAACTAACT  322716
322717  CAAATATTACGTATCAATAATCAATTAAATGTTGACATTATCTTAAGTTC  322766
322767  AACTAAAGCTGACAAAATTTTTAAGTTAGCACAACGTTTAAATGTAAAAA  322816
322817  AGCTTATAATATTAGCTAAAAAAGAATGATCAGATAAAAAAATAATTTTA  322866
322867  AAAGATTTACTTAATTTTAAACAAGATTTATTAAGTTTAGATGAAATTAA  322916
322917  AGGAATAAGGTAA                                       322929

Los Alamos National Laboratory     
Operated by the University of California for the National Nuclear Security Administration,
of the US Department of Energy.     Copyright © 2001 UC | Disclaimer/Privacy