Basic Search | Intermediate Search | Advanced SQL Search | Gene Image Map |  Home

Ureaplasma urealyticum

 Gene Flanking Sequence Viewer
This view is based on a particular gene which is displayed with some associated information above the sequence. You may add on "Flanking sequence" either upstream (Start Flank Size) or downstream (Stop Flank Size). You may specify the number of sequence characters per line and choose whether or not you want coordinates displayed to the right, left, or both left and right of the sequence. The sequence displayed is the sense strand relative to the gene the viewer is displaying. In reading the coordinates, note that there is no zero coordinate and that the genomic sequence is assumed to be circular.
Start Flank Size:
Stop Flank Size:
Characters per line:
Show Coordinates on: Left: Right:


Gene ID:UU215
Strand:Forward
Gene Start: 257688
Gene Stop: 258431
Gene Length:   744

257688  ATGAATTTTGGGTTTATTAGTGATATTGGCTCACAACGCAAACATAATGA  257737
257738  TGATTGTGCATTGGTAATTCAAAATCAATATCAACAAACTTTATTAATTG  257787
257788  TTTGTGATGGATTAGGCGGGTATAAAGGTGGTGCTGCGGCTAGCCACATT  257837
257838  ACATTAGAAACAATTAAAGATAATTTTTTAACTACAGATTTTAGTGAGTA  257887
257888  TGATAAACAACAGATTCAAAAATGGTATATTAAAGTTATTAAACTAGCAC  257937
257938  AGGTTGAAATTGATCGCACTGTTTTACTAGATAAAGACGTTTATAATATG  257987
257988  GGAACTACAGTTGTTGCTTCTATTGTTGTTAATGATTTTTCATACACTCT  258037
258038  AAATATTGGTGATTCGCGTGCTTATTTATTATCCAATGAACAATTCTTAC  258087
258088  AAATAAGTCGCGATCATAATTTATTACAAGTTTTACAAGAACGTAAAGCC  258137
258138  AACCCTGAGGTTTATAAAAAACATGAGAAGAATTTATTTTCATTAACACA  258187
258188  ATTTGTTGGTCGCACAAGTAATATTTTTTTGAGTTATGACTTATTCGTAA  258237
258238  ATAAATTAAACCCAAATGAAATTATTGTTTTAACATCAGATGGATTCCAT  258287
258288  AACTATTTTGAATTAAATACATTATATGAAAAATTAATAAAAAGCACCCA  258337
258338  AGAGACAAAAAATGAACTTTTACAACAATTAATAAGACAAGCTATTATCA  258387
258388  ACGGTAGCAATGATAATTTATCATTAGCTTTCTTAATTTTTTAA        258431

Los Alamos National Laboratory     
Operated by the University of California for the National Nuclear Security Administration,
of the US Department of Energy.     Copyright © 2001 UC | Disclaimer/Privacy