Basic Search | Intermediate Search | Advanced SQL Search | Gene Image Map |  Home

Ureaplasma urealyticum

 Gene Flanking Sequence Viewer
This view is based on a particular gene which is displayed with some associated information above the sequence. You may add on "Flanking sequence" either upstream (Start Flank Size) or downstream (Stop Flank Size). You may specify the number of sequence characters per line and choose whether or not you want coordinates displayed to the right, left, or both left and right of the sequence. The sequence displayed is the sense strand relative to the gene the viewer is displaying. In reading the coordinates, note that there is no zero coordinate and that the genomic sequence is assumed to be circular.
Start Flank Size:
Stop Flank Size:
Characters per line:
Show Coordinates on: Left: Right:


Gene ID:UU105
Strand:Forward
Gene Start: 132856
Gene Stop: 135021
Gene Length:   2166

132856  ATGTATTTTTTAAAAAAAATAGTAAATTTATTTAGTTCAAAAATTGAATC  132905
132906  AGAAGATAATAATGTTAAAAAAGACGACTTAACTCAACCACGTAAACAAT  132955
132956  CGCCAGAAGCGCGCAAACGAAGAAATCGAAGAATTATATTTTGATTAATT  133005
133006  ATTTTATTAATTATAGGAACAATTATTGGAGTTATTATTTATTTTTCTGT  133055
133056  TCGTAAAGAATATGATAACGTAATTGTTAAAAGTGCTCAAACAGAAGTTG  133105
133106  TTAATAACAAAAAAGTTTTATATTTAAATACTATTAGGCCTAATAGCACT  133155
133156  CAAATAACACGTTATACAATTGATGAAGATCAACTACTTACTGCACGTGT  133205
133206  TAATATTTTAAATAATACTAATTTTCAAATAATTTCTAATGCATCAAGTT  133255
133256  TAGGGCTGTCAAGAATCTCATTTAATATTGTGCGTGAAGGTGTTGAAAAG  133305
133306  TTTAAACTTGGTGAAACAAATATCTATGCACCAATTTCTGGGAATACTAA  133355
133356  TAATCAATGAAATTGGTTAACATCTATTATTACTCAAAATGCAGGAATTC  133405
133406  CATCTTCTGGCTTTAATCCACAAGTTATTATTTCTCCATTAATTTCAATT  133455
133456  ATTTTCTTCATAATTTTCTTATACATTATTTTACGTGTTTCTAAAGCACA  133505
133506  AAGCGACTCTTTATTAGGAACTAATAAGGCGAATGCTAAACTAACAAAAT  133555
133556  CTGGTGTTCGCTTTAGTGATGTTGCTGGAATTGCTGAGGTTAAAGAAGAA  133605
133606  TTAATTGAAATTGTTGATTTCTTAAAAGAACCTAAAAAATATGTTGCTGC  133655
133656  TGGTGCTAGAATCCCAAAAGGTGTAATGTTATATGGACCTCCAGGAACAG  133705
133706  GAAAAACATTAATTGCTAAAGCTGTAGCTGGTGAAGCTAATGTTCCATTC  133755
133756  TTTCAAACAACGGGTTCATCTTTTGAAGATACTTTTGTTGGAGTTGGTGC  133805
133806  ACGTCGTGTGAGAGAATTATTTGAAAAAGCACGTAAGAGTGCTCCCGCCA  133855
133856  TTATTTTTATTGATGAAATTGACTCAGTAGCTAAAAAACGTGGTAATTCA  133905
133906  TTAACTGCTGTACAAGACCAAACAATTAACCAATTATTATCAGAATTAGA  133955
133956  TGGTTTTGATACTTCAAGTGGTGTAATTGTTATGGCTGCGACAAATAGAT  134005
134006  TAGACACATTAGATGACGCAATTTTACGTCCTGGACGTTTTGACCGACAA  134055
134056  ATTAGTGTTAACTTACCAGATATTTTAGAACGTGAACAAATTTTAAGAAT  134105
134106  TCACTCACGTAATAAAAACTTATCTGCGAAAGTTAGTTTAGAAGATATTG  134155
134156  CACGTCGTACTGCTGGATTTAGTGGTGCACAATTAGAAAATGTTTTAAAT  134205
134206  GAAGCCGCATTACTATCAGTTAGAGATAAAGCAACATCAATTCATATGAA  134255
134256  TCATTTAGATGAAGCGATTGATCGTGTTATTGCAGGACCTTCACGTCCTA  134305
134306  ATAAAGTTATTTCTGAACGTGAACGTGAACAAGTTTCATACCATGAAGCT  134355
134356  GGACATGCATTAATTGGTTTATATTCACCAGGTGCTGATGTTGTTCAGAA  134405
134406  AATTACTATTGTTGCTCGTGGTCGAGCTGCTGGTTATACACTACAAACTC  134455
134456  CTGAAAGAAATGAAAATATTTTACAAAATAAAACTGAATTAATTAGTCGA  134505
134506  GTGCGTACTGCATTAGGTGGTCGAGCTGCAGAAGAGTTAATTTATGGACC  134555
134556  TAATGAAATTACAACAGGTGCAGCAAATGACTTTTATAAAATTACAAACA  134605
134606  TCGTAAGAGCAATGGTAGCTTCTTTTGGAATGACAGATGTGGGTTTAACG  134655
134656  CAATATATTGCTACTGAAGGTGTTGATAACCCTTATCGAAATAGTTATTC  134705
134706  AGAACAAACAGCATTAGCAATTGATATTGAAATTGAAAAAATTATTCAAC  134755
134756  GTGAATATAAAATTGTTAAAGAAATGATTAATGAACATCGTGAAGAATTG  134805
134806  GAATTAATCGTTCAAACATTATTAGAATTAGAAACAATTTTAAAGCCACA  134855
134856  AATTGATTATATTCACCAATACAAACAATTACCACCAGAGGTAATTGCTA  134905
134906  ATAAAAACAAACGTGAAGCTTCTCAAAAACAAGCAAATAGTAGTGTAGAA  134955
134956  GAAGCAAAAGTTGTTGACGATGAAGAATCAATAAAAGATAAAGAAAAAGA  135005
135006  TCAAAAATCTAACTAA                                    135021

Los Alamos National Laboratory     
Operated by the University of California for the National Nuclear Security Administration,
of the US Department of Energy.     Copyright © 2001 UC | Disclaimer/Privacy