Basic Search | Intermediate Search | Advanced SQL Search | Gene Image Map |  Home

Ureaplasma urealyticum

 Gene Flanking Sequence Viewer
This view is based on a particular gene which is displayed with some associated information above the sequence. You may add on "Flanking sequence" either upstream (Start Flank Size) or downstream (Stop Flank Size). You may specify the number of sequence characters per line and choose whether or not you want coordinates displayed to the right, left, or both left and right of the sequence. The sequence displayed is the sense strand relative to the gene the viewer is displaying. In reading the coordinates, note that there is no zero coordinate and that the genomic sequence is assumed to be circular.
Start Flank Size:
Stop Flank Size:
Characters per line:
Show Coordinates on: Left: Right:


Gene ID:UU006
Strand:Forward
Gene Start: 4431
Gene Stop: 4895
Gene Length:   465

4431  ATGATAAAAAAAATTTATTTTGGTAATGATCATGCTGCTTATGAAATTAA  4480
4481  AGATCAAATTATCACTCATTTAAAACAAAAAGGTTATCAAATTATTGATG  4530
4531  AAGGTGCACAAGCCGCATTAGGTTCTGTTGATTATAGTACATATGCATTA  4580
4581  AAAGTTGCTAATGACGTTGTTAATGATACTAAAAATGATAGCATAGGTAT  4630
4631  TTTATTATGTGGCACGGGAATAGGTATGAATATAGCAGCAAGCAAAGTGC  4680
4681  ATGGAACGCGGGTTGCGTTAGTGTATAACGAAAGCAGTGCAAAACTAGCC  4730
4731  AAGGAGCATAATAATGCTAACATAATTACTATAGGAGCACGTGAAAATAG  4780
4781  TTTAAACCAAATTCTTAAAATGATTGATGATTTTTTAACAAGTAAATTTT  4830
4831  TAGGCGAGCGTCACCAAAAACGTTTAGATATAATTGCAAAATATGAAAAA  4880
4881  GAGCAAAATAGTTAA                                     4895

Los Alamos National Laboratory     
Operated by the University of California for the National Nuclear Security Administration,
of the US Department of Energy.     Copyright © 2001 UC | Disclaimer/Privacy