Basic Search | Intermediate Search | Advanced SQL Search | Gene Image Map |  Home

Treponema pallidum

 Gene Flanking Sequence Viewer
This view is based on a particular gene which is displayed with some associated information above the sequence. You may add on "Flanking sequence" either upstream (Start Flank Size) or downstream (Stop Flank Size). You may specify the number of sequence characters per line and choose whether or not you want coordinates displayed to the right, left, or both left and right of the sequence. The sequence displayed is the sense strand relative to the gene the viewer is displaying. In reading the coordinates, note that there is no zero coordinate and that the genomic sequence is assumed to be circular.
Start Flank Size:
Stop Flank Size:
Characters per line:
Show Coordinates on: Left: Right:


Gene ID:TP1008
Strand: Reverse Compliment
Gene Start: 1100528
Gene Stop: 1097994
Gene Length:   2535

1100528  ATGCATATCATCAAGCGAAATGGCGAACCGCAACCTTACATGCGCGAGAA  1100479
1100478  AATAATTGTTGCTATCAGTGCTGCTTTTAGAAGTGTCCAGAATCCTCTTG  1100429
1100428  CTCCTGAAGTTCCTGCTATCATCACAGATCTTGCCGCGGAGGTTGAGCGA  1100379
1100378  CAGCTTTTTGAGATGAACCGTGCGGGCGTTCCTGTTCACGTGGAAAAGAT  1100329
1100328  TCAGGACTTTGTCGAAAAGACTCTTACCAAATACAATCACAGCGATGAAG  1100279
1100278  TGAAGAGTTTTATCCTGTACCGTGACGATCGCACAAAAAAGCGTATTGCA  1100229
1100228  AGAGAACAGATTGCGTGCTGTTTTACTGACTCTTCAGTGCTCGGTGTACT  1100179
1100178  GAAAGAAATCCAACAAGACTTTCCGTTTCCTGAGTACAGTCTCGATGCAC  1100129
1100128  TCGCCAGTAAGTTCCTGCTCTTTAAAAAAGAAGTTACGGACGAGCGTCGG  1100079
1100078  AGTATGCAACTGCTTATTAAGGCAGCGGTGGAACTGACTGCCCAAGAGGC  1100029
1100028  TCCCCAGTGGGAGCTTATTGCTGCGCGCTTGCTTATGCTCGACTTTTCAC  1099979
1099978  TCGCGCTAGGAACATCTTTGGAAAAGTTAAATATTCACTCCTTCTACGAG  1099929
1099928  AAAATAACTTATCTTGAAGAGGCCGGTCTATATGGGGTGTACATCCGCAC  1099879
1099878  GCACTATAGTCGGGCAGAAATTGAGGAAGCTGCCACGTATCTTGAGTGTA  1099829
1099828  GTCGCGATAAATTGTTTACGTACAGCAGTCTGGATATGATTCTGCGTCGC  1099779
1099778  TATGTGATCAGAACGCGTGCGCATGTACCTCTTGAAACTCCTCAGGAGAT  1099729
1099728  GTTTCTCGGTATTGCACTGCATCTAGCGATGAATGAAACCCAAGATCGTA  1099679
1099678  TGCAATGGGTAAAACGCTTTTATACAGTCCTCAGCAAGTTGCAGGTTACG  1099629
1099628  GTCGCAACACCTACGCTTTCAAACGCGCGCAAACCTTTTCATCAACTTTC  1099579
1099578  CTCGTGTTTCGTTGATACGGTGCCAGATTCGCTCGACGGTATCTACCGCA  1099529
1099528  GCATCGACAATTTTTCCCAGGTATCTAAGTTTGGGGGAGGGATGGGGCTG  1099479
1099478  TACTTTGGAAAAGTGCGTGCGGTAGGCGCTCCCATTCGGGGGTTCCAGGG  1099429
1099428  TGCTGCAGGTGGTATTCTCCGTTGGATTAAGCTCGCCAATGATACTGCAG  1099379
1099378  TTGCAGTAGATCAACTAGGAGTACGCCAAGGCTCGGTGGCAGTGTATTTG  1099329
1099328  GATGTATGGCACAAGGATATTCCGGAATTTTTGCAATTACGGACTAATAA  1099279
1099278  TGGGGATGACCGCATGAAAGCACATGACGTATTTCCTGCGGTCTGTTATC  1099229
1099228  CAGATTTGTTCTGGAAGACAGTACGCGATAATTTGGGGGCGTCGTGGTAT  1099179
1099178  TTAATGTGTCCGCATGAGATTCTTACGGTGAAAGGCTATGCTTTGGAGGA  1099129
1099128  TTTTTATGCGGAGGAATGGGAGAAGCGCTACTGGGATTGTGTAAAGGATG  1099079
1099078  CGCGTATCTCTAAGAGGACCATTCCGATTAAGGAGTTGGTGCGCTTGGTG  1099029
1099028  CTAAAATCTGTGGTGGAAACCGGTACTCCCTTTGCGTTTTACCGAGATCA  1098979
1098978  TGCAAACCGTGCAAATCCCAATGGGCATCGGGGAATTATTTACTGTTCTA  1098929
1098928  ATTTGTGTACTGAAATTGCGCAGAACATGAGCGCTATTAATTTAGTAAGC  1098879
1098878  GTAAAAATCACCGAGGTTGATGGACAAAAGGTAGTGGTGCAGACAACGCG  1098829
1098828  GCCGGGGGATTTTGTTGTATGTAACCTCGCGTCGTTGGTGCTGAGCAATA  1098779
1098778  TTGACCTTTCAGATGATAAGGAGTTGCGCGAGGTAGTGCGTGTGGCGGTA  1098729
1098728  CGTGCATTAGACAACGTGATCGATTTGACATATTATCCGGTTCCCTATGC  1098679
1098678  ACAGGTAACCAATGCGTATTATCGTGCTATTGGTTTAGGTGTTTCAGGCT  1098629
1098628  ACCATCACGTGCTTGCCCAGCAAGGAATCGATTGGGAAAGTGATGAACAT  1098579
1098578  CTTGCATTTGCGGACAGAATATTTGAGCGCATTAACCGTGCCGCAATTGA  1098529
1098528  AGCGAGTATGACAATCGCGCGCGAGAAGGGTGCGTATGGGTGTTTCACTG  1098479
1098478  GGAGCGATTGGTGTACCGGTGCGTATTTTCGCAAACGCGGCTATGTCTCT  1098429
1098428  GAAGACTGGCAACGTTTGCAGCGTGAGGTAGCAACACATGGGATGCGCAA  1098379
1098378  CGGTTACTTACTTGCAGTCGCGCCAACTAGTTCTACGTCTATCATTGCAG  1098329
1098328  GGACCACTGCGGGTGTAGATCCTATTATGAAGCAGTATTTCCTCGAGGAA  1098279
1098278  AAGAAAGGCATGCTAATGCCACGCGTAGCTCCTTCTCTTTCGCAGAAGAC  1098229
1098228  CTGTCCACTGTATAAAAGTGCACACGCAGTGGAGCAGCGTTGGAGTATCC  1098179
1098178  GTGCTGCGGGTCTGCGGCAACGACATATTGACCAGGCACAGTCAGTGAAT  1098129
1098128  CTGTACATTACAACGGACTTTACACTGAAGCAGGTTCTAGATTTGTACGT  1098079
1098078  GTATGCGTGGGAAGTAGGAATGAAGTCACTATACTACGTACGAAGCCAGT  1098029
1098028  CGCTCGAAATAGATTTGTGTGGGTATTGTGCCTCG                 1097994

Los Alamos National Laboratory     
Operated by the University of California for the National Nuclear Security Administration,
of the US Department of Energy.     Copyright © 2001 UC | Disclaimer/Privacy