Basic Search | Intermediate Search | Advanced SQL Search | Gene Image Map |  Home

Treponema pallidum

 Gene Flanking Sequence Viewer
This view is based on a particular gene which is displayed with some associated information above the sequence. You may add on "Flanking sequence" either upstream (Start Flank Size) or downstream (Stop Flank Size). You may specify the number of sequence characters per line and choose whether or not you want coordinates displayed to the right, left, or both left and right of the sequence. The sequence displayed is the sense strand relative to the gene the viewer is displaying. In reading the coordinates, note that there is no zero coordinate and that the genomic sequence is assumed to be circular.
Start Flank Size:
Stop Flank Size:
Characters per line:
Show Coordinates on: Left: Right:


Gene ID:TP0885
Strand: Reverse Compliment
Gene Start: 962945
Gene Stop: 962508
Gene Length:   438

962945  ATGATCCGTGTGCGAGCTGTCGTGTATCCGGGAGCTTCTTTTCCCGAGTA  962896
962895  CCAGACGTTAGGCTCAAGTGGAGCCGATTTGCGGGCCTTTCTTCCCGGAG  962846
962845  GACCGCTTGAGGTTCATCCCCTGGGCCGGGTTCTCGTCCCCACGGGTGTT  962796
962795  TGTGTGGAGCTTCCTGTGGGGTTGGAGATGCAAATTCGTCCCCGCTCTGG  962746
962745  GTTAGCACTCGAATACGGAGTGACGGTTTTAAATTCCCCGGGAACGATAG  962696
962695  ACGCTGACTACCGGGGGGAAATACGCGTGTTGCTTGTCAACCTTGGGCTA  962646
962645  GCTGCTTTCGTAGTCTCCCATGGAGATCGTATCGCGCAGGCGGTGATTTC  962596
962595  TTCTGTGCTCCGTGTTGAATATGTGCGCTCCGGTAGTATCTCGCTGACTG  962546
962545  AACGGGGAAAAGGAGGGTACGGATCCACAGGGGTTCTG              962508

Los Alamos National Laboratory     
Operated by the University of California for the National Nuclear Security Administration,
of the US Department of Energy.     Copyright © 2001 UC | Disclaimer/Privacy