Basic Search | Intermediate Search | Advanced SQL Search | Gene Image Map |  Home

Neisseria gonorrhoeae

 Gene Flanking Sequence Viewer
This view is based on a particular gene which is displayed with some associated information above the sequence. You may add on "Flanking sequence" either upstream (Start Flank Size) or downstream (Stop Flank Size). You may specify the number of sequence characters per line and choose whether or not you want coordinates displayed to the right, left, or both left and right of the sequence. The sequence displayed is the sense strand relative to the gene the viewer is displaying. In reading the coordinates, note that there is no zero coordinate and that the genomic sequence is assumed to be circular.
Start Flank Size:
Stop Flank Size:
Characters per line:
Show Coordinates on: Left: Right:


Gene ID:NG1466
Strand: Reverse Compliment
Gene Start: 1430753
Gene Stop: 1429176
Gene Length:   1578

1430753  ATGTCCGTCATCAAACGCGCCCTGATCAGCCTGTCCGACAAGGCAGGCGC  1430704
1430703  GGTCGAATTTGCCCAAAACCTGCACAAGCTCGGTGTCGAAATCCTCTCCA  1430654
1430653  CCGGCGGCACGGCGAAACTGCTTGCCGGTGCGGGCGTTCCCGTGATTGAA  1430604
1430603  GTCGCCGACTACACCGGTTTTCCCGAAATGCTCGACGGCCGCGTGAAAAC  1430554
1430553  CCTGCATCCGAAAATCCACGGCGGTATTTTGGGCCGGCGCGATTTGGACG  1430504
1430503  AACACGTCGCCAAGATGGAAGAGCACGGCATCGGCAACATCGACCTTGTG  1430454
1430453  TGTGTCAATCTTTACCCCTTCGCCGCCACCATCGCCAAGCCCGGCTGCAC  1430404
1430403  ACTGGAAGACGCGATTGAAAACATCGACATCGGCGGCCCGACTATGGTGC  1430354
1430353  GCTCCGCCGCGAAAAACTGGAAACACGTCGCCATCGTTACCGACACCGCC  1430304
1430303  GACTTCCCCGCCATTGCCGCCGAACTCGAAGCCAACAACGGCGCGTTGAG  1430254
1430253  CGATAAAACCCGCTTCAACCTCTCACGCAAAGCATTCAGCCACACCGCCC  1430204
1430203  AATACGACGGCATGATTTCCAACTATTTAACCTCGCTTTCAGACGGTGTT  1430154
1430153  TTGAGCGGAGAGCCTGAAATCGGCGAATTCCCAAGCCGGTTCAACCAAAG  1430104
1430103  CTGGATTAAAGTGCAAGACATGCGCTACGGCGAAAACCCGCATCAGCGCG  1430054
1430053  CCGCGTTTTACCGCGATATTGACCCCGCCGCAGGCAGCCTTTCCGCCTAC  1430004
1430003  AATCAACTGCAAGGCAAAGAATTGTCTTACAACAACATCGCCGATGCCGA  1429954
1429953  TGCCGCTTGGGAAGCCGTCAAATCCTTTGACGCGCCCGCCTGCGTGATCG  1429904
1429903  TGAAACACGCCAATCCGTGCGGCGTAGCCGTTGCAGCCGATACCTTGACC  1429854
1429853  GCCTACAAACTCGCCTACGCCACCGACACCACCAGCGCGTTCGGCGGCAT  1429804
1429803  CATCGCCTTCAACCGCGAAGTCGACGGCGAAACCGTCAAACAGATTACCG  1429754
1429753  ACAACCAATTTATGGAAGTCCTCATGGCGCCGAAGTTTACCGCCGAAGCC  1429704
1429703  CTTGAAATCGCCGCCGCCAAGAAAAACGTGCGCGTATTGGAAGTGCCGCT  1429654
1429653  CAAAGCAGGTGCCAACCGCTTTGAACTCAAACGCGTCGGCGGCGGACTGT  1429604
1429603  TGGTACAAACGCCCGACATCAACCGCATCAACCGCGCCGATTTGAAAGTC  1429554
1429553  GTCTCCAAACGCCAACCGACCGAGCAGGAATGGAACGATTTGCTGTTTGT  1429504
1429503  CTGGAACGTCGCAAAATACGTCAAATCCAACGCCATCGTCTTCGGCAAAG  1429454
1429453  GCGGCCAAACCTACGGTATCGGCGCAGGCCAAATGAGCCGCGTGGACAGC  1429404
1429403  ACCCGCATCGCCGCCCGCAAAGCGCAAGATGCCGGTCTCGACCTCAACGG  1429354
1429353  CGCATGTGCCGCTTCCGATGCCTTCTTCCCATTCCGCGACGGCGTGGACG  1429304
1429303  TGATTGCCGAACAGGGCATCAAAGCCATCATCCATCCGGCAGGCTCGATG  1429254
1429253  CGCGATCAGGAAGTTTTCGACGCGGCGGACGAACACGGCATCGCCATGGC  1429204
1429203  GGTAACCGGCATCCGCCACTTCCGCCAT                        1429176

Los Alamos National Laboratory     
Operated by the University of California for the National Nuclear Security Administration,
of the US Department of Energy.     Copyright © 2001 UC | Disclaimer/Privacy