Basic Search | Intermediate Search | Advanced SQL Search | Gene Image Map |  Home

Neisseria gonorrhoeae

 Gene Flanking Sequence Viewer
This view is based on a particular gene which is displayed with some associated information above the sequence. You may add on "Flanking sequence" either upstream (Start Flank Size) or downstream (Stop Flank Size). You may specify the number of sequence characters per line and choose whether or not you want coordinates displayed to the right, left, or both left and right of the sequence. The sequence displayed is the sense strand relative to the gene the viewer is displaying. In reading the coordinates, note that there is no zero coordinate and that the genomic sequence is assumed to be circular.
Start Flank Size:
Stop Flank Size:
Characters per line:
Show Coordinates on: Left: Right:


Gene ID:NG0610
Strand:Forward
Gene Start: 597522
Gene Stop: 598346
Gene Length:   825

597522  ATGCCGGAATTGCCGGAAGTGGAAACGACGTTGCGCGGCATCGCGCCGCA  597571
597572  TATTGAAGGAAAAACGGTGGAAGCCGTGATATTGCGCCAACTGAAGCTGC  597621
597622  GCTGGCAGATCAATCCCGATTTGGGGGAGATTTTGTCCGGCCGGCAGGTT  597671
597672  TTGTCCTGCGGCAGGCGTGCCAAATATCTGATTGTCCGTTTCCAAACGGG  597721
597722  GATTTTGCTGATTCACTTGGGGATGTCGGGCAGCTTGCGGATCTTTACGC  597771
597772  CGTCGGACGGACGTATCGGCAGGCCGGACAGACACGATCACGTCGATATT  597821
597822  GTGTTTTCAGACGGCACGGTCATGCGTTACCGCGATCCGAGAAAGTTCGG  597871
597872  CGCGATACTTTGGTATGAGGGAATCGAAGAACGTCATCCGCTGTTGGAAA  597921
597922  AACTGGGGCCGGAGCCTTTGTCGGAGGCATTTTGCACGGATTATCTGTAT  597971
597972  GCGGGGCTGAAGGCGCAGAAACGCGCGGTCAAACTCGCTCTGATGGACAA  598021
598022  TACCGTCGTGGTCGGCGTGGGCAATATTTATGCCAACGAGAGTCTGTTCA  598071
598072  GGGCGGGCATTTCGCCCCACCGTCCTGCCAACCGCCTAAAAAAGAAAGAG  598121
598122  TGCGCGGTTTTGGTTGAAACCGTCAAAGCGGTGTTGCAGCGCGCCATTGA  598171
598172  AACGGGCGGCAGTACGCTGAGGGATTTTGTGGACAGCGACGGCAAAAGCG  598221
598222  GCTACTTTCAACAGGAATATACGGTGTACGGGCGGCACAATCAGCCGTGC  598271
598272  CTCCGGTGCGGCGGTTTGGTTGTGAAAGAAACTTTGGGGCAGCGCGGCAC  598321
598322  GTTTTATTGCACGAACTGTCAGAAA                           598346

Los Alamos National Laboratory     
Operated by the University of California for the National Nuclear Security Administration,
of the US Department of Energy.     Copyright © 2001 UC | Disclaimer/Privacy