Basic Search | Intermediate Search | Advanced SQL Search | Gene Image Map |  Home

Mycoplasma genitalium

 Gene Flanking Sequence Viewer
This view is based on a particular gene which is displayed with some associated information above the sequence. You may add on "Flanking sequence" either upstream (Start Flank Size) or downstream (Stop Flank Size). You may specify the number of sequence characters per line and choose whether or not you want coordinates displayed to the right, left, or both left and right of the sequence. The sequence displayed is the sense strand relative to the gene the viewer is displaying. In reading the coordinates, note that there is no zero coordinate and that the genomic sequence is assumed to be circular.
Start Flank Size:
Stop Flank Size:
Characters per line:
Show Coordinates on: Left: Right:


Gene ID:MG385
Strand: Reverse Compliment
Gene Start: 484699
Gene Stop: 483992
Gene Length:   708

484699  ATGCGAAAACAGTTTTTAATAGCTTATCGCGGTTATAGTTCTATTGCACC  484650
484649  AGAAAACACCAAATTAGCATTTCAAGCAGCCCAAGTTTTTGATTTTGATG  484600
484599  GTATTTGAATTGATATTCAATTAACCAAAGATAAACAAATAGTAGTAACT  484550
484549  CATAAAGAAAACTTTAAAGTTTCTAATAAAAACTTGAATTTAAACCAAAT  484500
484499  TAATTTAGTTGATCTTAAAAAGGTTAACCTTGCAAGTGAATTTAAGCTTA  484450
484449  AGGTAACTTCACAACAAATTCAAACTTTAAAGGAAGTTTTAACGCAATTT  484400
484399  ATTCAGCCCTTTAAATATTTGCTGATTCATATTAAAGATGATAAAGAAAA  484350
484349  TAACAATTCATTATTAGAACAGTTGAATTTGCTTTGCAAAGATTTTGTCT  484300
484299  TAGCTAAAGAAAAAATGATTTTGTTAAGTAGTAATTTTCATATCATTAAG  484250
484249  TTAATAAATGAGACTTTCAAAGGCTTTAAAACCGGTTTTGTAATTGCAAA  484200
484199  CAAAAAAGCTTTATTAGTAGCTTCTAGAGACGAATTAATGAGATATTGCC  484150
484149  GTTTTTTAGTGCCAAACGAGAGTTTTTATCATAAGAACTGCAAAGAAATT  484100
484099  CAAAACCTGGGATTACCAGTTATTCTTTGAGTTATCAAGGGTCTTCTTCG  484050
484049  TTATCAATTTTATGAAAACGATCGCTTTGTGAAATTTCAAATTACTGCAC  484000
483999  AAATTTAT                                            483992

Los Alamos National Laboratory     
Operated by the University of California for the National Nuclear Security Administration,
of the US Department of Energy.     Copyright © 2001 UC | Disclaimer/Privacy