Basic Search | Intermediate Search | Advanced SQL Search | Gene Image Map |  Home

Mycoplasma genitalium

 Gene Flanking Sequence Viewer
This view is based on a particular gene which is displayed with some associated information above the sequence. You may add on "Flanking sequence" either upstream (Start Flank Size) or downstream (Stop Flank Size). You may specify the number of sequence characters per line and choose whether or not you want coordinates displayed to the right, left, or both left and right of the sequence. The sequence displayed is the sense strand relative to the gene the viewer is displaying. In reading the coordinates, note that there is no zero coordinate and that the genomic sequence is assumed to be circular.
Start Flank Size:
Stop Flank Size:
Characters per line:
Show Coordinates on: Left: Right:


Gene ID:MG235
Strand:Forward
Gene Start: 279798
Gene Stop: 280670
Gene Length:   873

279798  ATGCCTAAGCTACTGGGTAGCTTTATTAGCTTTAAAGCCCCCAATTACTT  279847
279848  TGTTCAAAGTGCTCAGGATGCAATTGCTATTGATGCAACTGCTCTAATGG  279897
279898  TATTTTTAGGTCCACCCCATTCTGCTTACCGTGTTCCTTTTAACAAGATG  279947
279948  CAGTTTAGTTTGGGCTATGAGTTGTTAAAAACAAAGAATATTAATAGTAA  279997
279998  TGGTTTGGTTGTTCATGCTCCATATATCATTAACTGTGCATCAAAAGACC  280047
280048  CACTAAAACAGCAGAATGCTATCAGTGTTTTAACCAATGAGATTCAGCTT  280097
280098  TGTAACTTGGCTGGTGCTCACTATTTAGTTTTGCATCCAGGTTCTGCAGT  280147
280148  AGCCCAAACAACCAACGAAGCATTAGATAACCTGGTTAAAGTACTCAATC  280197
280198  AAGTTATCAATAAAACCAAAACAACAGTTATTTGCCTTGAAACAATGGCT  280247
280248  GGTAAGGGTAATGAGATAGGCAGAGACTTAACTGAGTTGAAATATGTTAT  280297
280298  TGACAGGATCGTTGATAAAGATAGGATCGGGGTTTGTCTTGATACCTGTC  280347
280348  ACTTCCATGATAGTGGGATTGACTTTAGTGATCTAACTGGTGTTTTTAAC  280397
280398  ACCATTACAACTAAACTTGGTTTTGAGTTTCTCAAAGTAATCCATTTAAA  280447
280448  TGAATCTAAAAATAATTGTGGTTCTAAAAAAGATAGGCATGCTAATATCA  280497
280498  ATGCTGGGATGATTGGTTTTGAGAACTTAATGAAGTTCATTAGTCACCCC  280547
280548  CAAATTAAGGATTTACCTATTATCTTAGAAACCCCTTCAACTAGTTTAAA  280597
280598  CTACCCAACTATTTACCGTGAAGAGATTAGTCAAATCCGCAGCTGATTTA  280647
280648  AAACTTACCAACCAGATGCTAAC                             280670

Los Alamos National Laboratory     
Operated by the University of California for the National Nuclear Security Administration,
of the US Department of Energy.     Copyright © 2001 UC | Disclaimer/Privacy