Basic Search | Intermediate Search | Advanced SQL Search | Gene Image Map |  Home

Haemophilus ducreyi

 Gene Flanking Sequence Viewer
This view is based on a particular gene which is displayed with some associated information above the sequence. You may add on "Flanking sequence" either upstream (Start Flank Size) or downstream (Stop Flank Size). You may specify the number of sequence characters per line and choose whether or not you want coordinates displayed to the right, left, or both left and right of the sequence. The sequence displayed is the sense strand relative to the gene the viewer is displaying. In reading the coordinates, note that there is no zero coordinate and that the genomic sequence is assumed to be circular.
Start Flank Size:
Stop Flank Size:
Characters per line:
Show Coordinates on: Left: Right:


Gene ID:HD1847
Strand: Reverse Compliment
Gene Start: 1553844
Gene Stop: 1553041
Gene Length:   804

1553844  ATGCGTCTTATTCCCTTAAAAAATGATCAGCAAGTTGCAAAATGGGCAGC  1553795
1553794  GAGTTATATTGCTCAACGAATTAATCAATTTAAGCCAAGTGCAGAGCGTC  1553745
1553744  CTTTTGTATTAGGCTTACCAACGGGGGGAACACCCTTACAAACTTATCAA  1553695
1553694  GAGCTGATTAAGCTATATCAAGCGGGTGAAGTAAGTTTTAAATATGTCGT  1553645
1553644  GACCTTTAATATGGATGAATATGTTGGCTTAGCTCAAGATCATCCTGAAA  1553595
1553594  GTTATCATTCATTTATGCACAATAATTTTTTCAAGCATATCGATATTCAA  1553545
1553544  GCGCAGAATATTAATATTCTAGACGGCAATACGGATGATCATCAGCAAGA  1553495
1553494  ATGTCATCGTTATGAAGAAAAAATTAAATATTACGGCAAAATTCATTTAT  1553445
1553444  TTATGGGCGGTGTTGGGATTGATGGGCATATTGCCTTTAATGAACCGGCT  1553395
1553394  TCCTCATTGGGTTCTCGGACGCGGATTAAAACGTTGACAGAAGATACCCT  1553345
1553344  AATTGCCAACTCTCGTTTCTTTAATAACGATATCAGCCAAGTGCCTAAAT  1553295
1553294  ATGCGTTAACAATTGGGGTTGCAACGTTATTGGATGCAGAAGAAATAATG  1553245
1553244  TTATTGATCACCGGTTATAACAAAGCGTTGGCATTACAGGCTGGCGTAGA  1553195
1553194  AGGTTCCGTTAATCATTTATGGACAGTCAGTGCTTTACAATTACATGAAC  1553145
1553144  GCAGTATTATTGTTTGTGATGAACCCGCCACACAAGAATTAAAAGTAAAA  1553095
1553094  ACGGTGAAATATTTTACGCAATTAGAAGCACAAGAAATTGCAAGTGTATG  1553045
1553044  CTAG                                                1553041

Los Alamos National Laboratory     
Operated by the University of California for the National Nuclear Security Administration,
of the US Department of Energy.     Copyright © 2001 UC | Disclaimer/Privacy