Basic Search | Intermediate Search | Advanced SQL Search | Gene Image Map |  Home

Haemophilus ducreyi

 Gene Flanking Sequence Viewer
This view is based on a particular gene which is displayed with some associated information above the sequence. You may add on "Flanking sequence" either upstream (Start Flank Size) or downstream (Stop Flank Size). You may specify the number of sequence characters per line and choose whether or not you want coordinates displayed to the right, left, or both left and right of the sequence. The sequence displayed is the sense strand relative to the gene the viewer is displaying. In reading the coordinates, note that there is no zero coordinate and that the genomic sequence is assumed to be circular.
Start Flank Size:
Stop Flank Size:
Characters per line:
Show Coordinates on: Left: Right:


Gene ID:HD1690
Strand: Reverse Compliment
Gene Start: 1410365
Gene Stop: 1407735
Gene Length:   2631

1410365  ATGCAATTAAAATTTGAAGAACTCACCCACCAACAGCAAGCCATTGAAGC  1410316
1410315  GGTGATTGCCTTATTTAAAGGCGAATTAAATAAAACCACGGAATTTTCCC  1410266
1410265  TTAATAACCTAGGCAGTCAGCCGATTATGGCAAATCAGCTGGCGTTACCC  1410216
1410215  CTTGAAGAAGTCGAGAAAAATTTAAATGCGGTGCAGGAGAAATTTCATCA  1410166
1410165  AAAAACGACCGCTCTTTCCGATCACGGTTTGCATTTTTCCGTTGAAATGG  1410116
1410115  AAACGGGTACGGGCAAAACTTATGTCTATTTACACACCATTTTTGAGTTA  1410066
1410065  AATAAACAATACGGCTGGCAGAAATTTGTGATTGTCGTGCCAAGTGTCGC  1410016
1410015  CATTCGTGAAGGCGTACAACAAACCGTACGAACCACCGCCGAACATTTTA  1409966
1409965  CTAATTTGTTTGATAAACCGACCGTTAATACCACGGTATATCGTAGCGAC  1409916
1409915  AGGCTAAATGCGCTACGCAGTTTTGCCACTAATAACCAGATTGAAATCTT  1409866
1409865  GATTATGAACATTGACAGCTTTAAAAAAGATGACAATGTGATTAACCGTA  1409816
1409815  TAAACGAGAGTGGCGAAGCCCCGATTTTGCAAATTAGCCAAACTCAGCCA  1409766
1409765  ATTGTTATCATTGATGAACCGCAAAATATGGAAACAGATTTAGCCAAACA  1409716
1409715  GGCGATAGAAGCCCTGAATCCGCTATTTGTATTGCGTTATTCTGCCACGC  1409666
1409665  ATAAAAATCCATACCATAAAATTTATAGCTTAAATCCGTTAGACGCTTAT  1409616
1409615  AACCAAAAATTGGTAAAACAAATCGAAGTCGAACCTGTGCTGGCAGAAAA  1409566
1409565  CGATGTGAACGGGGCTTATGTGGTGCTAAAAGAGCCTGTGGTTGGCAAAG  1409516
1409515  GTAAACTCAAAGCCAAAATTGAAATTCACGTTCAAACGGAGAAAGAAACG  1409466
1409465  AAGAAAAAAGTAGTTACCATTCAAGCAGGTGATGATCTCTATGAAAAATC  1409416
1409415  AGGCAAAAATGAGAGTTATCGACACGGGTTTATTATCAATGAGTTAAGTG  1409366
1409365  CCGATCCATTTGAGATCCACTTATCTAATGGGCAAGTGCTTACACAAAGT  1409316
1409315  GAAGATGATGATCTCTTGCGTGATGAAATTATGAAAAAGCAGATGGAGTG  1409266
1409265  CACCATTAAAGAGCATTTAGCCAAAGAAAAATGGCTGAATAGCAAAGGCA  1409216
1409215  TTAAAGTGCTTTCGCTGTTTTTTATTGATAAGGTGGCAAATTACCGTGAT  1409166
1409165  AACGGTAAATTTTATCGCTGGTTCAATGAAATCTATGAGCGTGAAACAGG  1409116
1409115  AAAAAGTGCGGTAGGTGTACACAATGGTTATTTTTCTCAAGATAATAAAG  1409066
1409065  GCAAAGAAACGGATACCAAAGGGAATTCAAAAGCGGACGAAGACACTTAC  1409016
1409015  GATTTAATTATGCGAGATAAAGAAAAACTGCTTTCTTTTGATTCACCGTT  1408966
1408965  ACGTTTTATTTTTTCTCATTCCGCTTTAAAAGAGGGCTGGGATAACCCAA  1408916
1408915  ATGTGTTTCAAATTTGTACGCTAAATGAAACTCGTTCACCCATTAAAAAA  1408866
1408865  CGTCAAGAAATTGGGCGAGGCTTACGTTTGGCGGTAAATCAGCAAGGCGA  1408816
1408815  ACGTATTTATGATGAAAGTGTAAATATCCTCACTGTTATTCCTAATGAAA  1408766
1408765  GCTATCAAAGTTTTGCTGCAAATCTCCAAAAAGAATATGAAGATGAATGC  1408716
1408715  GGAATTAAATTTACCAATGGTGGTGTAAAATCAAAACAAGCTCGCTTACA  1408666
1408665  ACAACATTATCGAAAAGGTTTTACCCTTGATCCCGCATTTATTGAAATTT  1408616
1408615  GGCAAAAGTTACAGCAAAAAACACTTTATTCCGTGCGATTTGAACGAGAA  1408566
1408565  AAATTGATTGAAAGTGCTGTAAAATTGATGAGCGAAATGCCTGCTATTCA  1408516
1408515  ACGGGTACAACTGAATGTACAAAAGGCAAAACTACGTCAATCTGAACAAG  1408466
1408465  GAATTTGGGGGGAAGAAACCAATTCTCGCTATGCAGAAATTGATACTCAT  1408416
1408415  TGGGAAATCCCTGATGTATTGCAAGCTATTCAGCGCAAAACCCAATTAAC  1408366
1408365  TCGCCAAACAATTTGTGAAATTTTGCAAAAATCCGACCGCTTGCAAGAGC  1408316
1408315  TTGCCAATAATCCACAACGCTTTATTGATATGGTAAGTGAGAAAATTCTA  1408266
1408265  CAAGCCTTAAATGGTTTAATGATTGATGGTATTGAGTATTCCCAAGTTGA  1408216
1408215  ACCACAAGAAAATAGCTATGAACAAACCTTAATTCAATGGCAAGAATTGG  1408166
1408165  AGAAAAATGGTTTGGAAATCTTTTTCAATGAGCATACCTTTGAAGTCAAT  1408116
1408115  CAAAGTGATAAAGAAAAACAACAAAAAACCATTTTTGCTAATTATATATC  1408066
1408065  ACTGGATTCGCACACTGAAAAACAGTTCGCCCAAGAATGTGAAAACAACG  1408016
1408015  AAGATGTGCGAATGTATTTTAAATTGCCTAACTGGTTTAAAATTCCTACC  1407966
1407965  CCAATCGGTAATTACAACCCTGACTGGGCGGTGGTAATGAATAACCGTTC  1407916
1407915  AAAAGTTTATTTTGTGGCGGAAACTAAAAATACAGGTAAAGGCATTCAAT  1407866
1407865  CAGGAGTTGATGAAAGTTTGCTTAGCTTAACTGAACGTCAAAAAATCCAA  1407816
1407815  TGCGCTAAAAAACATTTTTCTTTAAATATTTTTGATGGAGTGAAATATCA  1407766
1407765  GGTTGTAGAAAAATTATCTGAGATTAGCTAG                     1407735

Los Alamos National Laboratory     
Operated by the University of California for the National Nuclear Security Administration,
of the US Department of Energy.     Copyright © 2001 UC | Disclaimer/Privacy