Basic Search | Intermediate Search | Advanced SQL Search | Gene Image Map |  Home

Haemophilus ducreyi

 Gene Flanking Sequence Viewer
This view is based on a particular gene which is displayed with some associated information above the sequence. You may add on "Flanking sequence" either upstream (Start Flank Size) or downstream (Stop Flank Size). You may specify the number of sequence characters per line and choose whether or not you want coordinates displayed to the right, left, or both left and right of the sequence. The sequence displayed is the sense strand relative to the gene the viewer is displaying. In reading the coordinates, note that there is no zero coordinate and that the genomic sequence is assumed to be circular.
Start Flank Size:
Stop Flank Size:
Characters per line:
Show Coordinates on: Left: Right:


Gene ID:HD1107
Strand:Forward
Gene Start: 882024
Gene Stop: 882917
Gene Length:   894

882024  ATGATTATGTCCGTCCCACTCTTTCACGGCAGTATTGTTGCTTTATTAAC  882073
882074  GCCGATGACGCATGGCGAAGTTAATTACCAAGAGATAAAAAATTTAGTTG  882123
882124  AATATCATATTCAAGCGGGTTCACATGGCATTGTGGCAATGGGGACGACC  882173
882174  GGTGAATCTACAACCCTCAGTATTGATGAACACGTGAAAGTAATTAAGAA  882223
882224  AACCGTAGAGTTTGCTGATGGAAGAATTCCCATTATTGCTGGTTCCGGCT  882273
882274  CAAATGCAACGAGTGAAGCGGTAACCATTACTAAATTATTGAATGGTGTT  882323
882324  GGCGTTGTGGGCTGTCTAAGTGTTGTGCCGTATTATAATAAACCTACTCA  882373
882374  AGAAGGATTATATTTACATTATAAAGCGATTGCCGAAAGCACCGAACTAC  882423
882424  CTCAAATTTTATATAATGTGCCAAGTCGAACAGGCTGTGATTTAAAACCC  882473
882474  GAAACAATCGGGCGTTTGTCAGAAATTCCTAATATTATCGGGGTAAAGGA  882523
882524  AGCGACAGGCGATTTAACTCGCTTGCCTTTAATTAAAACATTAGCGGGCG  882573
882574  AAGATTTCATTTTTTTAAGTGGTGATGATGCCACTGGCTTAGAGTCAATG  882623
882624  AAATTAGGCGGACAAGGTGTAATATCGGTGACTAATAATCTGGCAGCAGC  882673
882674  GGATATGGCTAAAATGTGTGAATTAGTTTTAGCAGGCAATTTTGCTGAAG  882723
882724  CAGAAGCAATTAATCAACGTTTGATTGATTTACATCACGATTTATTTATT  882773
882774  GAAGCAAATCCAATCCCAGTAAAATGGGCGGCTTATAAATTAGGGTTGAT  882823
882824  TAGTGAGCCTAGCTTACGCTTGCCGCTTACACCACTTTCTGAAACCGCAC  882873
882874  AACCCACTATATTAAAAGCGCTACAAAAAGCAGGTTTAATTTAG        882917

Los Alamos National Laboratory     
Operated by the University of California for the National Nuclear Security Administration,
of the US Department of Energy.     Copyright © 2001 UC | Disclaimer/Privacy