Basic Search | Intermediate Search | Advanced SQL Search | Gene Image Map |  Home

Haemophilus ducreyi

 Gene Flanking Sequence Viewer
This view is based on a particular gene which is displayed with some associated information above the sequence. You may add on "Flanking sequence" either upstream (Start Flank Size) or downstream (Stop Flank Size). You may specify the number of sequence characters per line and choose whether or not you want coordinates displayed to the right, left, or both left and right of the sequence. The sequence displayed is the sense strand relative to the gene the viewer is displaying. In reading the coordinates, note that there is no zero coordinate and that the genomic sequence is assumed to be circular.
Start Flank Size:
Stop Flank Size:
Characters per line:
Show Coordinates on: Left: Right:


Gene ID:HD0232
Strand: Reverse Compliment
Gene Start: 171992
Gene Stop: 170988
Gene Length:   1005

171992  ATGGCTTTTAATCTTAAAAATAGACACTTGCTCAGCTTAGTCAATCACAC  171943
171942  AGAACGTGAAATTAAATACTTATTAGCATTAGCACGTGATTTAAAACGTG  171893
171892  CAAAATATAGCGGTACTGAACAACAAACATTAAAAGGCAAAAATATTGCT  171843
171842  TTAATCTTTGAAAAAACATCTACCCGTACCCGTTGTGCGTTTGAAGTTGC  171793
171792  CGCTTATGATCAAGGTGCCCAAGTCACTTATATTGATCCAAACTCCTCTC  171743
171742  AAATTGGCCATAAAGAATCAATGAAAGACACTGCACGTGTATTAGGCAGA  171693
171692  ATGTATGATGCCATTCAATATCGTGGTTTTAAACAAGCCACTGTAAATGA  171643
171642  ATTAGCCAAATATGCGGGAGTGCCTGTTTTTAATGGTTTAACTGATGAAT  171593
171592  TCCATCCAACACAGATGCTCGCTGATGTATTAACTATGCTTGAAAATTGT  171543
171542  GAAAAACCATTAAATCAAATAAGCTATGTCTATATGGGTGATGCACGCAA  171493
171492  TAATATGGGTAATTCTTTATTACTTATTGGTGCTAAATTAGGTATGGACG  171443
171442  TCCGTATTTGTGCACCTCAAGCCTTACTGCCAGAAGACTCCTTGGTCACA  171393
171392  CTATGCCAACAATTTGCTCAACAATCTAACGCGCGCATTACCATCACAGA  171343
171342  TGATATAGATCTAGCAATACAAGGGGTCGATTTTATTCATACTGATGTAT  171293
171292  GGGTATCAATGGGTGAGCCGTTAGAGACGTGGGGCGAACGAATTAATATG  171243
171242  TTAATGCCTTATCAAGTGACTCCTGCGCTAATGCAACGTACAGGCAATCC  171193
171192  AAACGTAAAATTTATGCATTGTTTACCCGCTTTCCATAATAGTGAAACCA  171143
171142  CAATGGGTAAACAAATTGCTGAACAGTATCCACAGCTTGCAAACGGTATT  171093
171092  GAAGTAATAGAAGAAGTTTTTGAATCCAGTGCAAATATCGCCTTTGAACA  171043
171042  AGCTGAAAATCGAATGCACACCATTAAAGCCGTAATGGTAGCCAGCTTAG  170993
170992  CATAA                                               170988

Los Alamos National Laboratory     
Operated by the University of California for the National Nuclear Security Administration,
of the US Department of Energy.     Copyright © 2001 UC | Disclaimer/Privacy