Basic Search | Intermediate Search | Advanced SQL Search | Gene Image Map |  Home

Haemophilus ducreyi

 Gene Flanking Sequence Viewer
This view is based on a particular gene which is displayed with some associated information above the sequence. You may add on "Flanking sequence" either upstream (Start Flank Size) or downstream (Stop Flank Size). You may specify the number of sequence characters per line and choose whether or not you want coordinates displayed to the right, left, or both left and right of the sequence. The sequence displayed is the sense strand relative to the gene the viewer is displaying. In reading the coordinates, note that there is no zero coordinate and that the genomic sequence is assumed to be circular.
Start Flank Size:
Stop Flank Size:
Characters per line:
Show Coordinates on: Left: Right:


Gene ID:HD0038
Strand:Forward
Gene Start: 35412
Gene Stop: 36011
Gene Length:   600

35412  ATGGTTTTACTATTTGGAGCAAATGGCTTAGCGGGTCGTCAGTTACTGAC  35461
35462  ACAAGCGGTTGGACTGCAAATCGTTTCCGTATTACGCCAGCCCTCGGAAG  35511
35512  ATCCCTTTTTTAGTCAACGGCAAACAGTCATTGCCGATGTAATGAACCAA  35561
35562  GCTGAATGTGAAGCGGTGATCACTCAGACTAAGCCACGTGTAGTGATTAG  35611
35612  TTTTATTGGTGGTAAAAAAGACGGTGTACGTAGTGATGCCACGGGTAATA  35661
35662  TCAATATTATCAATGCTATTAAAAAATGCGCACCAACCGCTCGCTTTATT  35711
35712  TTTGTGACCAGTATGGGCTGTGGTGAACAATTTGATGAATTGCCTGCTTC  35761
35762  AGTCAAGCAATTTTTAGGTGAAGCATTAGCAGAAAAAACAGTCGCAGAAG  35811
35812  AGGCATTACGCGCAAGCGGGTTAAATTGGACGATTTTACGCCCATGTGGG  35861
35862  TTAAATACCGAACAAGGCGATACCTTTACGCTAAGTGATACAAAACAACT  35911
35912  ACCTGAACGTTATATGAGCCGTAAAGCTTTGGCGAATGCGGTATTAAGTG  35961
35962  TATTAGATCGAAATGATGTTCAGCATCAGATTTTCTCGGTAACACAATAA  36011

Los Alamos National Laboratory     
Operated by the University of California for the National Nuclear Security Administration,
of the US Department of Energy.     Copyright © 2001 UC | Disclaimer/Privacy