Basic Search | Intermediate Search | Advanced SQL Search | Gene Image Map |  Home

Chlamydia pneumoniae

 Gene Flanking Sequence Viewer
This view is based on a particular gene which is displayed with some associated information above the sequence. You may add on "Flanking sequence" either upstream (Start Flank Size) or downstream (Stop Flank Size). You may specify the number of sequence characters per line and choose whether or not you want coordinates displayed to the right, left, or both left and right of the sequence. The sequence displayed is the sense strand relative to the gene the viewer is displaying. In reading the coordinates, note that there is no zero coordinate and that the genomic sequence is assumed to be circular.
Start Flank Size:
Stop Flank Size:
Characters per line:
Show Coordinates on: Left: Right:


Gene ID:CPn0829
Strand:Forward
Gene Start: 936744
Gene Stop: 937301
Gene Length:   558

936744  GTGCCAACTTTGGCGAAATCCTTTTATATAAATATAAGAGATTCAAGGTT  936793
936794  TTATTCATGGCTTTGCTTTATAATGAAGGAAACGTACTACCGCGACTTTC  936843
936844  TTCATGAGAACTATTTGAAAAACAAGAAGAGCATGTTTATGAAAATTTAT  936893
936894  AAAACTGCAGGGGAGTTTTTTTTAGCAAATGCAAAATGGCCCTTGGTACC  936943
936944  GGCTGGGTATCGACGTGTTCGAGGAAAAGATTTTGTTCTATCCCCGCTCG  936993
936994  TGGACTTAGTGATTCTATTTCCTTGGGTAACCAAAGACTCCCGATATTCA  937043
937044  CCTTGCAGCATGACATTCACTTGTATTTGTAGGAGTATAGTAGAGTGTAT  937093
937094  TCCTGTTGTAAGTACATTATTTGGTATCGGACGATTTTGTGCTGTGTGGT  937143
937144  GCGTTGAAGGTTTCTCAGGCTCTACGTTTGATAAGATCTATCATACAATT  937193
937194  GTCGCCGTTCTAGGAATTCTTGGTTTGGGAATTCTTACGTTCATTTTAAG  937243
937244  AATTATTTTTTCTGTGCTTATGTTGCCCGTCTGGTTCTTATTTAAGTGTT  937293
937294  ATTCTTAG                                            937301

Los Alamos National Laboratory     
Operated by the University of California for the National Nuclear Security Administration,
of the US Department of Energy.     Copyright © 2001 UC | Disclaimer/Privacy