Basic Search | Intermediate Search | Advanced SQL Search | Gene Image Map |  Home

Chlamydia pneumoniae

 Gene Flanking Sequence Viewer
This view is based on a particular gene which is displayed with some associated information above the sequence. You may add on "Flanking sequence" either upstream (Start Flank Size) or downstream (Stop Flank Size). You may specify the number of sequence characters per line and choose whether or not you want coordinates displayed to the right, left, or both left and right of the sequence. The sequence displayed is the sense strand relative to the gene the viewer is displaying. In reading the coordinates, note that there is no zero coordinate and that the genomic sequence is assumed to be circular.
Start Flank Size:
Stop Flank Size:
Characters per line:
Show Coordinates on: Left: Right:


Gene ID:CPn0819
Strand:Forward
Gene Start: 928689
Gene Stop: 929135
Gene Length:   447

928689  TTGAGTAACATCATGGGGTCTCGACGTAAACTTAAACGTAGCTTTTTACT  928738
928739  TATAGAAGTCCTGATGGCGCTTTCTTTGGTTTGTGCAGTGCTCTTGCCCT  928788
928789  GCATCAGATTTTACTACGCCATCCACAGGTCTTTTGAGGAAGATATTTTT  928838
928839  AATTTGCAATTGCCAGCCCTGATCGACCACTGCTTTCTATCTGTTGAAGA  928888
928889  AAAGATGCGTCAGCAAATGGCAGAAGGAACTGTTCTCACCTCAGGGAAAG  928938
928939  GGCAGACAGTTTCTTTAGCATATACCAGTCAGGGGATAGGCTATCGGATC  928988
928989  CCTTATGGTTACAATGTAGATATCCGTCAGGAAGTCCGTGGTGATAATCT  929038
929039  TAAGATGAAAGTTTGCCTTGCCGATGTTGTTGTGGAACTTTTCCCAGATC  929088
929089  AGAAACAAGCAGTATCCGTACAGAGATGCCTATGTGTAACTCTATAG     929135

Los Alamos National Laboratory     
Operated by the University of California for the National Nuclear Security Administration,
of the US Department of Energy.     Copyright © 2001 UC | Disclaimer/Privacy