Basic Search | Intermediate Search | Advanced SQL Search | Gene Image Map |  Home

Chlamydia pneumoniae

 Gene Flanking Sequence Viewer
This view is based on a particular gene which is displayed with some associated information above the sequence. You may add on "Flanking sequence" either upstream (Start Flank Size) or downstream (Stop Flank Size). You may specify the number of sequence characters per line and choose whether or not you want coordinates displayed to the right, left, or both left and right of the sequence. The sequence displayed is the sense strand relative to the gene the viewer is displaying. In reading the coordinates, note that there is no zero coordinate and that the genomic sequence is assumed to be circular.
Start Flank Size:
Stop Flank Size:
Characters per line:
Show Coordinates on: Left: Right:


Gene ID:CPn0499
Strand: Reverse Compliment
Gene Start: 580359
Gene Stop: 579202
Gene Length:   1158

580359  ATGTCGTCAGTAAATCAAAGCTCTGGAACCCCGAATCCAGAAGAGGTAAC  580310
580309  TTCTCCTGAATCTACGGAAGAAAACAAAAATGTTGTTTCTTCAGATGAGG  580260
580259  CGCAAGCCACGCATGCTGTGGCTCTTCCTATAGTCACTCAACTTTCTCTT  580210
580209  CCTGAAGGTGTGGGGACCTCATCTGAAGAAACGGCGAGTAATCCGAGGGT  580160
580159  AGACGAGATTGTAGCTGAAGTTTCTTCGAGTCGGGCGGTTGCTGATCAGA  580110
580109  TCTCATCACTTGTAGAGCGTGTTGGAGAGCTTTTAGACGACCTTAAGGGT  580060
580059  GCCCAGTCCCTTTTCACTAGCTTTCAGTCAGAGTTGAAAAACTGTCTTCC  580010
580009  GGCATGGAAATCTTCAACGAGAAGACTCGAAACTCGAGGTGCTGGGGATA  579960
579959  ATGCGGATATAGCGAGGCTGGAATTATTTCGTAGCGATTACGAGGCTGTC  579910
579909  TTAGGCCATGCGAACCAGTTTCATGGGAAGGCTCATCTCATTTTAAGTAA  579860
579859  GTTAACAGATGTACATCACAAGCTACAGGGACTCAGTCGTGAAGATCTTT  579810
579809  CCCTGGCGTTTGACAATAATGATAGGGTTCTTGAGCATCTGGGTTCGTTA  579760
579759  GGGCTTGATGTAGACGCTGAAGGTAATTGGTCTCTTTCTTGTGAGAGGGG  579710
579709  GATTCCGCGACTGGTGCTTACTGCTGACAGTATGCTTGTCCAGATCAAGA  579660
579659  AAGTGAATCTACCTACTGTAGAAGAATTGCGGACTCTTCAGGGAACAACG  579610
579609  GAATCTTCGTCTGATCCTAGGGTTGAAGAAAGTTTGTCTTGCTGTGAAAG  579560
579559  ATTGCTCAATGAATTACGTCGTCTTTGGGCGAATTTTGTAGGTTTTATTT  579510
579509  CGAGTTGCTATGACAACATCGTGTTTGTTTTGATGTGGATAGTGAGACGG  579460
579459  ATTAACCTTTTGCCTGGGCTGGGGTGTTTGCCTTTCCATAATCCCGATGC  579410
579409  TTCTCAAGAAGACCAGAGGTCTTCTTCCGGAGAGCGTTCTACAAGGAGAG  579360
579359  AACGCCTTTCTCGGCGATCTGACTTATCTGAGGAAGAGATGATTGTGAGA  579310
579309  GCTGAGGGAGAGTCTATACATCCTGAATCTCCCCATGGAGATGGCCGTAA  579260
579259  CCAACCTAGTCGAGGTGATAAGCAAGACTCTGATAGTGAGGAAGAGACGG  579210
579209  AGTTATAA                                            579202

Los Alamos National Laboratory     
Operated by the University of California for the National Nuclear Security Administration,
of the US Department of Energy.     Copyright © 2001 UC | Disclaimer/Privacy