Basic Search | Intermediate Search | Advanced SQL Search | Gene Image Map |  Home

Chlamydia pneumoniae

 Gene Flanking Sequence Viewer
This view is based on a particular gene which is displayed with some associated information above the sequence. You may add on "Flanking sequence" either upstream (Start Flank Size) or downstream (Stop Flank Size). You may specify the number of sequence characters per line and choose whether or not you want coordinates displayed to the right, left, or both left and right of the sequence. The sequence displayed is the sense strand relative to the gene the viewer is displaying. In reading the coordinates, note that there is no zero coordinate and that the genomic sequence is assumed to be circular.
Start Flank Size:
Stop Flank Size:
Characters per line:
Show Coordinates on: Left: Right:


Gene ID:CPn0481
Strand: Reverse Compliment
Gene Start: 560946
Gene Stop: 559336
Gene Length:   1611

560946  ATGGCAACCTCTGTTCCTGTAACTTCATCTACTTCTGTAGGAGAGGCTAA  560897
560896  CTCCTCCAACGAAAGATTTACTGAACGAACATCGCGAATGTATTACGCAG  560847
560846  CTTTAGTCCTAGGGGCTTTGAGCTGTTTAATTTTTATTGCTATGATTGTC  560797
560796  ATTTTCCCACAGGTCGGATTGTGGGCTGTGGTCCTCGGGTTTGCTCTTGG  560747
560746  ATGTTTACTTTTAAGCTTAGCTATCGTTTTTGCTGTCTCCGGTCTCGTTT  560697
560696  TAGGCAAGACTTTAGAACCTAGTCGAGAAGCGACTCCTCCAGAAATTGTT  560647
560646  GCGCAAAAGGAGTGGACTACACAACAAGATGTCTTAGGGAATGAGTATTG  560597
560596  GCGTTCCGAGTTGATTTCCTTGTTCTTACGAGGGGATCTCCACGAATCTC  560547
560546  TGATTGTTGATTCTAAGGATCGATCTTTAGATATTGATCAGAGTTTACAA  560497
560496  AATATATTGAAACTTGAGCCCCTATCTACGACACTTTCGCTGTTAAAGAA  560447
560446  AGATTGTGTCCACATCAATATCATTTTACATTTAGTGAGACAGTGGAACT  560397
560396  TACTGGGAGTGGATCTTAGTCCTGAAGTCACTGCGCACGCCGAGGAACTT  560347
560346  CTACTCTTTTTGATAGAAGAGCAGTATTACTCTCCTGATATTTTGAAATT  560297
560296  GATTCGCTACGGAGATGCTTTACAAGCAACGTCTCCTTTGATGGATTGGG  560247
560246  CAGATTCAGGTTCCTTTAGTGTAGACGCAGACGGGGTATTTAGCTGTCGC  560197
560196  AGAGAAGAATGTTCTCCTGAGGATGCTTTGGCGCAATTCGATCTTCTTTT  560147
560146  GGCGTTGGAAAATCCCGACAGACGCTTCTTAAAGGATTCTTTTCTTACCT  560097
560096  ACATTTGGTCGTCTTCATTTTTTGAGAAGTTTTTACATCGCCATCTAGAG  560047
560046  AGCTTGCAAAGAAAGCTCCCAGAGACAGCGATCGATGTCGCCCGCTATGA  559997
559996  AGCACAAATACAAACATTTCTCTCTCGCTATTTTCAGAAGCTCGATTTGA  559947
559946  TAAACGCAATGTCCTTAGATTGGGGATATAACTGTGCTGAGGGAGAAAAA  559897
559896  TGTTATGAGAGCGCAAATCAAAGATTAGACAACCTATTTATTGCTTTTTC  559847
559846  TTCTTCTGTTCCTGCTATGAAGCGGCTCTTTGACAAATATGGTTCTGTGG  559797
559796  TACGGGTAGATCGTAGGCAGATTCGTGAGCAGATTCTTTCGAACACTGAA  559747
559746  ATCTTAGAAAATGAGTCAGGGTTCCTCTGCAGTTTGTATGAATATCCTTT  559697
559696  ATCCTATTTGATAGATTGGGCTGTTTTGCTAGACTGTGTTCGCGGTACCG  559647
559646  AAATCTCTCTAGAAGATCAGGCCGATTACACCGTTTGTTTGCAAGGCTTG  559597
559596  GATTCTATGTTATCTCAATTTGCGAGTCGTTTACAGTCTGGACAAAAAGT  559547
559546  ATTGAATCCTAGAGATGTTTTAAGTGAACAGGCTGCGGTTATGCTTGTTC  559497
559496  ATGGCTTGGCAGCACAGGGCGTGTCGTTTCAAGGATTGAAAGCTTTGATG  559447
559446  TATTTGACAGCCGTTCCCCAAAGAATGTGGTTAGGAGCATTGCCTTTATT  559397
559396  TGAATCTTTTCCTGTCTTTAATCGGATGAAAGAATTTCTTGGGGAATCTC  559347
559346  TGGGAGACTAG                                         559336

Los Alamos National Laboratory     
Operated by the University of California for the National Nuclear Security Administration,
of the US Department of Energy.     Copyright © 2001 UC | Disclaimer/Privacy