Basic Search | Intermediate Search | Advanced SQL Search | Gene Image Map |  Home

Chlamydia pneumoniae

 Gene Flanking Sequence Viewer
This view is based on a particular gene which is displayed with some associated information above the sequence. You may add on "Flanking sequence" either upstream (Start Flank Size) or downstream (Stop Flank Size). You may specify the number of sequence characters per line and choose whether or not you want coordinates displayed to the right, left, or both left and right of the sequence. The sequence displayed is the sense strand relative to the gene the viewer is displaying. In reading the coordinates, note that there is no zero coordinate and that the genomic sequence is assumed to be circular.
Start Flank Size:
Stop Flank Size:
Characters per line:
Show Coordinates on: Left: Right:


Gene ID:CPn0420
Strand: Reverse Compliment
Gene Start: 467108
Gene Stop: 466821
Gene Length:   288

467108  ATGAACAAAAGTCGTTTTTTACGTTTATGCTGCTGTCTATGCTTTTGTGG  467059
467058  AAGTCTCTTTTATTTCTATATTAATAAGCAGAACTCGCTGACGAAATTAC  467009
467008  GCCTCGAAATTCCTTGTTTATCTGTACGCTTGCGTCAGCTTGAGCAGCAA  466959
466958  AATATTTCTTTACGTTTTTTAATTGATAAAATAGAAAGACCTGATCATTT  466909
466908  GATGGAAATAGCAGCTCTTCCCGAATACCAATATTTGGAATATCCCTCAG  466859
466858  AAGAAAGTATCAGTCTTTTATCCTATGAGCTACCGTAA              466821

Los Alamos National Laboratory     
Operated by the University of California for the National Nuclear Security Administration,
of the US Department of Energy.     Copyright © 2001 UC | Disclaimer/Privacy