Basic Search | Intermediate Search | Advanced SQL Search | Gene Image Map |  Home

Chlamydia pneumoniae

 Gene Flanking Sequence Viewer
This view is based on a particular gene which is displayed with some associated information above the sequence. You may add on "Flanking sequence" either upstream (Start Flank Size) or downstream (Stop Flank Size). You may specify the number of sequence characters per line and choose whether or not you want coordinates displayed to the right, left, or both left and right of the sequence. The sequence displayed is the sense strand relative to the gene the viewer is displaying. In reading the coordinates, note that there is no zero coordinate and that the genomic sequence is assumed to be circular.
Start Flank Size:
Stop Flank Size:
Characters per line:
Show Coordinates on: Left: Right:


Gene ID:CPn0349
Strand: Reverse Compliment
Gene Start: 392770
Gene Stop: 391787
Gene Length:   984

392770  ATGGATGCGAAAATGGGATATATATTTAAAGTGATGCGTTGGATTTTCTG  392721
392720  TTTCGTGGCATGTGGTATAACTTTTGGATGTACCAATTCTGGGTTTCAGA  392671
392670  ATGCAAATTCACGTCCTTGTATACTATCCATGAATCGCATGATTCATGAT  392621
392620  TGTGTTGAAAGAGTCGTGGGGAATAGGCTTGCTACCGCTGTTTTGATCAA  392571
392570  AGGATCCTTAGACCCTCATGCGTATGAGATGGTTAAAGGGGATAAGGACA  392521
392520  AGATTGCTGGAAGTGCCGTAATTTTTTGTAACGGCCTGGGTCTTGAGCAT  392471
392470  ACATTAAGTTTGCGGAAGCATTTAGAAAATAATCCCAATAGTGTCAAGTT  392421
392420  AGGGGAGCGGTTGATAGCGCGTGGGGCCTTTGTTCCTCTAGAAGAAGACG  392371
392370  GTATTTGCGATCCTCATATCTGGATGGATCTTTCTATTTGGAAGGAAGCT  392321
392320  GTCATAGAAATTACAGAAGTTCTCATTGAAAAGTTCCCTGAATGGTCTGC  392271
392270  TGAATTTAAAGCAAATAGTGAGGAACTTGTTTGTGAAATGTCTATTTTAG  392221
392220  ATTCTTGGGCGAAACAATGCTTGAGCACAATTCCTGAAAATTTACGGTAT  392171
392170  CTTGTCTCAGGTCATAATGCGTTCAGTTACTTTACACGTCGCTATTTAGC  392121
392120  TACTCCTGAAGAAGTGGCTTCCGGAGCATGGAGGTCTCGTTGTATTTCTC  392071
392070  CTGAGGGTCTATCTCCAGAAGCTCAAATCAGTGTTCGTGATATTATGGCG  392021
392020  GTTGTAGATTATATTAATGAGCATGATGTCAGTGTGGTTTTCCCTGAGGA  391971
391970  TACTCTGAACCAAGATGCGTTGAAAAAAATTGTTTCTTCTCTGAAGAAAA  391921
391920  GTCATTTAGTTCGTCTAGCTCAAAAACCATTGTATAGTGATAATGTGGAC  391871
391870  GACAATTATTTTAGCACCTTTAAACATAATGTCTGCCTTATCACAGAAGA  391821
391820  ATTAGGAGGGGTGGCTCTTGAATGTCAAAGATGA                  391787

Los Alamos National Laboratory     
Operated by the University of California for the National Nuclear Security Administration,
of the US Department of Energy.     Copyright © 2001 UC | Disclaimer/Privacy