Basic Search | Intermediate Search | Advanced SQL Search | Gene Image Map |  Home

Chlamydia pneumoniae

 Gene Flanking Sequence Viewer
This view is based on a particular gene which is displayed with some associated information above the sequence. You may add on "Flanking sequence" either upstream (Start Flank Size) or downstream (Stop Flank Size). You may specify the number of sequence characters per line and choose whether or not you want coordinates displayed to the right, left, or both left and right of the sequence. The sequence displayed is the sense strand relative to the gene the viewer is displaying. In reading the coordinates, note that there is no zero coordinate and that the genomic sequence is assumed to be circular.
Start Flank Size:
Stop Flank Size:
Characters per line:
Show Coordinates on: Left: Right:


Gene ID:CPn0315
Strand:Forward
Gene Start: 356977
Gene Stop: 358719
Gene Length:   1743

356977  ATGCCAAAACAAGCTGAATATACTTGGGGATCTAAAAAAATTCTGGACAA  357026
357027  TATAGAATGCCTCACAGAAGACGTTGCCGAATTTAAAGATTTGCTTTATA  357076
357077  CGGCACACAGAATTACTTCGAGCGAAGAAGAATCTGATAACGAAATACAG  357126
357127  CCTGGCGCCATCCTAAAAGGTACCGTAGTTGATATTAATAAAGACTTTGT  357176
357177  CGTAGTTGATGTTGGTCTGAAGTCTGAGGGAGTGATCCCTATGTCAGAGT  357226
357227  TCATAGACTCTTCAGAAGGTTTAGTGCTTGGAGCTGAAGTAGAAGTCTAT  357276
357277  CTCGACCAAGCCGAAGACGAAGAGGGCAAAGTTGTCCTTTCTAGAGAAAA  357326
357327  AGCCACACGACAACGTCAATGGGAATACATCTTAGCTCATTGTGAAGAAG  357376
357377  GTTCTATTGTTAAAGGTCAAATTACACGTAAAGTCAAAGGCGGCCTTATT  357426
357427  GTAGATATTGGAATGGAAGCCTTCCTACCTGGATCACAAATTGACAACAA  357476
357477  GAAAATCAAAAATTTAGATGATTATGTCGGAAAAGTTTGTGAATTCAAAA  357526
357527  TTTTAAAAATTAACGTTGAACGTCGCAATATTGTTGTCTCAAGAAGAGAA  357576
357577  CTCTTAGAAGCTGAGAGAATCTCTAAGAAAGCCGAACTTATTGAACAAAT  357626
357627  TTCTATCGGAGAATACCGCAAAGGAGTTGTTAAAAACATTACTGACTTTG  357676
357677  GTGTATTCTTAGATCTCGATGGTATTGACGGTCTTCTCCACATTACCGAT  357726
357727  ATGACCTGGAAGCGCATACGACATCCTTCCGAAATGGTCGAATTGAATCA  357776
357777  AGAGTTGGAAGTAATTATTTTAAGCGTAGATAAAGAAAAAGGACGAGTTG  357826
357827  CTCTAGGTCTCAAACAAAAAGAGCATAATCCTTGGGAAGATATTGAGAAG  357876
357877  AAATACCCTCCTGGAAAACGAGTTCTTGGTAAAATTGTGAAGCTTCTCCC  357926
357927  CTACGGAGCTTTCATTGAAATTGAAGAGGGCATTGAAGGTCTAATTCACA  357976
357977  TTTCTGAAATGTCTTGGGTGAAAAATATTGTAGATCCTAGTGAAGTCGTA  358026
358027  AATAAAGGCGATGAAGTTGAAGCCATTGTTCTATCTATTCAGAAGGACGA  358076
358077  AGGAAAAATTTCTCTAGGATTAAAGCAAACAGAACGTAATCCTTGGGACA  358126
358127  ATATCGAAGAAAAATATCCTATAGGTCTCCATGTCAATGCTGAAATCAAG  358176
358177  AACTTAACCAATTACGGTGCTTTCGTTGAATTAGAACCAGGAATTGAGGG  358226
358227  TCTGATTCATATTTCTGACATGAGTTGGATTAAAAAAGTCTCTCACCCTT  358276
358277  CAGAACTATTCAAAAAAGGAAATTCTGTAGAGGCTGTTATTTTATCAGTA  358326
358327  GACAAAGAAAGTAAAAAAATTACTTTAGGAGTTAAGCAATTAAGTTCTAA  358376
358377  TCCTTGGAATGAAATTGAAGCTATGTTCCCTGCTGGCACAGTAATTTCAG  358426
358427  GAGTTGTGACTAAAATCACTGCATTTGGAGCCTTTGTTGAGCTACAAAAC  358476
358477  GGGATTGAAGGATTGATTCACGTTTCAGAACTTTCTGACAAGCCCTTTGC  358526
358527  AAAAATTGAAGATATTATCTCCATTGGAGAAAATGTTTCTGCAAAAGTAA  358576
358577  TTAAGCTAGATCCAGATCATAAAAAAGTTTCTCTTTCTGTAAAAGAATAC  358626
358627  TTAGCTGACAATGCTTATGATCAAGACTCTAGGACTGAATTAGATTTCAA  358676
358677  GGATTCTCAAGGCCCTAAAGAGAGAAAGAAAAAAGGAAAATAG         358719

Los Alamos National Laboratory     
Operated by the University of California for the National Nuclear Security Administration,
of the US Department of Energy.     Copyright © 2001 UC | Disclaimer/Privacy