Basic Search | Intermediate Search | Advanced SQL Search | Gene Image Map |  Home

Chlamydia pneumoniae

 Gene Flanking Sequence Viewer
This view is based on a particular gene which is displayed with some associated information above the sequence. You may add on "Flanking sequence" either upstream (Start Flank Size) or downstream (Stop Flank Size). You may specify the number of sequence characters per line and choose whether or not you want coordinates displayed to the right, left, or both left and right of the sequence. The sequence displayed is the sense strand relative to the gene the viewer is displaying. In reading the coordinates, note that there is no zero coordinate and that the genomic sequence is assumed to be circular.
Start Flank Size:
Stop Flank Size:
Characters per line:
Show Coordinates on: Left: Right:


Gene ID:CPn0280
Strand: Reverse Compliment
Gene Start: 314572
Gene Stop: 313547
Gene Length:   1026

314572  GTGTCAGAACAACATTCTCCTATCATTTCCGTTCAAGATGTTAGTAAGAA  314523
314522  GTTAGGCGACCATATTCTTCTCTCCAAAGTCTCCTTTTCTGTCTATCCTG  314473
314472  GAGAGGTTTTTGGTATAGTTGGTCATAGCGGTTCTGGGAAAACAACGCTT  314423
314422  TTGCGTTGTTTAGACTTTCTTGACATGCCGACATCTGGCTCTATAAGTGT  314373
314372  AGCTGGGTTTGATAACTCTTTGCCAACACAGAAGTTTTCACGTCGTAATT  314323
314322  TTTCTAAAAAAGTTGCCTATATTTCTCAAAATTATGGGTTGTTTTCTTCG  314273
314272  AAAACCGTATTTGAAAACATAGCCTATCCTTTGCGTATTCATCATTCAGA  314223
314222  AATGTCTAAGAGTGAAGTTGAGGAACAGGTATACGATACTCTTAATTTTT  314173
314172  TAAACCTCTATCATAGACATGACGCCTATCCAGGAAATTTAAGTGGTGGT  314123
314122  CAGAAACAAAAAGTTGCCATTGCCAGGGCAATTGTGTGTCAACCTGAAGT  314073
314072  TGTGCTTTGTGATGAGATTACCTCTGCTTTGGATCCTAAATCTACTGAAA  314023
314022  ATATTATTGAAAGGCTGCTTCAATTGAATCAGGAAAGGGGAATTACTTTA  313973
313972  GTTTTAGTGTCGCATGAGATCGATGTAGTAAAAAAAATATGCTCTCATGT  313923
313922  TTTGGTAATGCATCAAGGTGCTGTCGAAGAACTAGGAACTACAGAAGAAC  313873
313872  TTTTTTTAAATTCTGAGAACTCAATTACAAATGAATTGTTCCATGAAGAT  313823
313822  ATAAATATTGCTGCTTTGAGTTCGTGTTATTTTGCAGAAGACAGGGAAGA  313773
313772  AGTTCTTAGATTAAATTTTTCCAAAGAACTCGCTATACAAGGGATCATTA  313723
313722  GTAAGGTGATTCAGACTGGACTGGTCTCTATCAATATTCTTTCCGGCAAC  313673
313672  ATTAATTTATTTAGAAAATCCCCAATGGGATTTCTAATTATTGTTTTGGA  313623
313622  AGGGGAAGTTGAGCAACGTAAAAAAGCAAAAGAGCTTTTAATTGAGCTAG  313573
313572  GCGTCGTTATTAAAGAATTTTATTAG                          313547

Los Alamos National Laboratory     
Operated by the University of California for the National Nuclear Security Administration,
of the US Department of Energy.     Copyright © 2001 UC | Disclaimer/Privacy