Basic Search | Intermediate Search | Advanced SQL Search | Gene Image Map |  Home

Chlamydia pneumoniae

 Gene Flanking Sequence Viewer
This view is based on a particular gene which is displayed with some associated information above the sequence. You may add on "Flanking sequence" either upstream (Start Flank Size) or downstream (Stop Flank Size). You may specify the number of sequence characters per line and choose whether or not you want coordinates displayed to the right, left, or both left and right of the sequence. The sequence displayed is the sense strand relative to the gene the viewer is displaying. In reading the coordinates, note that there is no zero coordinate and that the genomic sequence is assumed to be circular.
Start Flank Size:
Stop Flank Size:
Characters per line:
Show Coordinates on: Left: Right:


Gene ID:CPn0251
Strand:Forward
Gene Start: 286060
Gene Stop: 287562
Gene Length:   1503

286060  ATGAGTCCTTTTAAGAAAATAGTAAATCGCTTACTATGCTATATTTCTTT  286109
286110  TCAAAAAGAATCAAGAACTCTCCCAATCATTATTAGAGAACCTAGGATGA  286159
286160  CAACAAAAAGTTTAGGATCTTTCAATTCAGTTATTTCCAAAAATAAAATT  286209
286210  CATTTTATTAGTTTGGGATGCTCTCGGAACCTTGTAGATAGCGAAGTCAT  286259
286260  GCTAGGCATTCTTCTTAAGGCAGGTTACGAGTCTACTAATGAAATTGAAG  286309
286310  ATGCTGACTATTTAATTTTAAATACCTGTGCGTTTTTAAAAAGTGCTAGA  286359
286360  GATGAAGCTAAAGATTATCTAGACCATCTAATTGATGTAAAAAAAGAGAA  286409
286410  CGCTAAAATTATTGTAACTGGATGCATGACTTCCAACCACAAAGATGAGC  286459
286460  TTAAACCCTGGATGTCACACATCCATTACCTACTAGGTTCTGGGGATGTT  286509
286510  GAGAATATTCTTTCTGCTATTGAGTCTCGTGAATCTGGAGAAAAAATCTC  286559
286560  TGCAAAGAGTTACATTGAGATGGGAGAAGTTCCAAGACAGCTTTCCACAC  286609
286610  CAAAACACTATGCCTATTTAAAAGTTGCTGAGGGCTGTAGAAAACGTTGT  286659
286660  GCTTTTTGTATTATTCCTTCCATTAAAGGAAAGCTCCGCAGCAAACCTCT  286709
286710  GGATCAAATTCTTAAAGAATTCCGCATCCTTGTAAACAAGAGTGTGAAAG  286759
286760  AGATTATATTGATAGCTCAAGACCTAGGAGATTATGGAAAGGATCTCTCT  286809
286810  ACAGACCGCAGTTCGCAGCTAGAATCACTATTACATGAGTTACTGAAAGA  286859
286860  GCCTGGTGATTATTGGCTGCGGATGTTGTATTTATATCCTGATGAAGTGA  286909
286910  GTGATGGCATTATAGATCTTATGCAATCTAATCCCAAACTTCTTCCCTAT  286959
286960  GTAGATATTCCCTTACAGCACATTAACGACCGTATTTTAAAGCAAATGCG  287009
287010  AAGAACGACTTCTAGGGAGCAAATCCTAGGATTCCTAGAAAAATTACGTG  287059
287060  CCAAGGTTCCTCAGGTCTATATCCGTTCTTCTGTTATTGTGGGTTTCCCC  287109
287110  GGTGAAACTCAGGAAGAATTCCAGGAGTTAGCTGATTTTATTGGTGAGGG  287159
287160  TTGGATTGATAATCTCGGAATTTTCTTGTACTCTCAAGAAGCGAATACCC  287209
287210  CGGCAGCAGAACTCCCTGACCAGATACCAGAAAAAGTTAAAGAATCGAGG  287259
287260  TTGAAAATTCTATCTCAAATTCAGAAACGCAATGTGGATAAACATAATCA  287309
287310  GAAGCTCATTGGGGAAAAAATAGAAGCAGTTATTGATAACTATCATCCTG  287359
287360  AAACGAATCTTTTACTCACTGCAAGGTTCTATGGACAAGCTCCTGAAGTG  287409
287410  GACCCTTGTATTATTGTAAATGAGGCGAAGCTTGTTTCTCATTTTGGAGA  287459
287460  AAGATGCTTTATAGAAATCACAGGGACTGCTGGTTACGACCTTGTAGGGC  287509
287510  GTGTTGTAAAAAAATCTCAGAACCAAGCTTTGCTAAAAACTAGCAAAGCT  287559
287560  TAG                                                 287562

Los Alamos National Laboratory     
Operated by the University of California for the National Nuclear Security Administration,
of the US Department of Energy.     Copyright © 2001 UC | Disclaimer/Privacy