Basic Search | Intermediate Search | Advanced SQL Search | Gene Image Map |  Home

Chlamydia trachomatis

 Gene Flanking Sequence Viewer
This view is based on a particular gene which is displayed with some associated information above the sequence. You may add on "Flanking sequence" either upstream (Start Flank Size) or downstream (Stop Flank Size). You may specify the number of sequence characters per line and choose whether or not you want coordinates displayed to the right, left, or both left and right of the sequence. The sequence displayed is the sense strand relative to the gene the viewer is displaying. In reading the coordinates, note that there is no zero coordinate and that the genomic sequence is assumed to be circular.
Start Flank Size:
Stop Flank Size:
Characters per line:
Show Coordinates on: Left: Right:


Gene ID:CT393
Strand:Forward
Gene Start: 448027
Gene Stop: 449769
Gene Length:   1743

448027  ATGAGAATGTCCCTCCTGTTTTACAGAACTTCCAAAAATGCAAATAAAGA  448076
448077  AGCCTCCGTTCTTTCCTACGAGCTTCTTCAGAAAGCAGGGTATCTTTTCA  448126
448127  AAACATCTAAAGGGATTTACTCATACACACCTCTCTTCCAACGAGTTATC  448176
448177  CTAAAAATGACCGAAATCATTCGTGAAGAACTCAATGCTATTGGAGGACA  448226
448227  AGAGGTCTGTCTCCCTCTCCTGCAACCAGCAGAACTATGGGAAAAAACCG  448276
448277  GTCGTTGGAAGGCCTTTTTATCGGAAAAATTACTCTATGTGCTTAAGGAT  448326
448327  AGAGAAAATAAGGCAATGTGTTTAGCCCCTACCCACGAAGAGGTTGTCTC  448376
448377  TGAATTCGTGGCTCAGTGGCTAACAGGACGAGAACAGCTCCCTATCCACC  448426
448427  TATACCAAATCGGAACCAAATTCCGAGATGAAATCCGACCTCGCTTTGGG  448476
448477  CTTATGCGTGCCAAAGAGTTCTTAATGGAAGATAGCTATACTTTTTCTGA  448526
448527  CTCTCCAGAACAAATGGAAGAACAGTATGCAAAGCTACGTCTAGCTTACC  448576
448577  AGCGCATCTTTGATCGATTAAATCTCAAATATGTAATTGTTGCTGCAGAT  448626
448627  GGAGGGAAAATTGGTAAGGGGAAATCTGAGGAATTCCATGTTCTCTGCTC  448676
448677  TTTAGGAGAAGACACGATCTGTGTGAGTGGGTCTTACGGAGCGAATGTAG  448726
448727  AAGCAGCACAAGCAATCCCTCCATCCTATGTTTACGATTCAAACCTTCTA  448776
448777  CCTGTAGAAGAAGTTGCGACTCCTAACATTCGAACAATTGAAGACTTAGA  448826
448827  AGTCTTTTTTAACACCCCTAAACATAAAATACTGAAAACTTTAGTTGTTA  448876
448877  AAACTTGCCAAAAAGACTCGGAGAAATTCTTTGCGATTTGTATCCGAGGG  448926
448927  GATCGTCAGATCAACTTAACCAAAGTTGCATCTTTCCTACAAGTTGATGA  448976
448977  CTGCGAGCTGGCTTCTGAGGAAGAGATCCTTAAGCATCTTCATGTTGAAA  449026
449027  AAGGATTTATCGGACCTCTATACTGTCCTATCCCCTGTTATGCAGACGAA  449076
449077  ACAACGCGCCCAATGACTAACTTCATCTGCGCAAACAACCAAAAAGACGT  449126
449127  GCACTGCAAGCATGTGAACTGGGGACGCGATATCCCTCTTCCAGCTTTCG  449176
449177  GAGACTTTCTTTTAGCAGAAGCTGGAGACCTTTGTCCTCAAAATGGAGGA  449226
449227  GCTCCCTATGAAATTTTCCAAGGCGTCGAAGTCGCTCATATCTTCAATCT  449276
449277  GGGAACCCGCTATACGGAGAGCTTCTCCGTAGGGTTCCAGGATAAAAATG  449326
449327  GAGATAAGCAGCTTTGCTGGATGGGGACATATGGTATTGGAGTAGGGAGA  449376
449377  ACCCTTGCTGCATGCATAGAACAGCTCGCTGATAACAAAGGACTGGTTTG  449426
449427  GCCTTTAGCTGTAGCTCCTTTCTCCATCACCATTCTCTATAATGGTGGTG  449476
449477  ATACGGAAGGAGAAGCCACCGCCTTACAACTTTATCAAAGCCTGAATACT  449526
449527  GAAGGCTTTGAGCCTCTACTAGATGATCGCAATGAACGCCTTGGGTTTAA  449576
449577  GTTAAAAGACAGCGATTTACTAGGTATCCCGTACAAATTGATCATTGGGA  449626
449627  AGTCTTTCCAAAGTACAGGCTTATTAGAAATCGAATCACGCTCAGGAGAA  449676
449677  AAATGTAATGTTTCTCCTGAAAACCTATTGGATTGGTGCTCTAAAAATCT  449726
449727  TCCTTGTCATACAAGAAAGATCCCTCCACTCCGAGAACAAAAC         449769

Los Alamos National Laboratory     
Operated by the University of California for the National Nuclear Security Administration,
of the US Department of Energy.     Copyright © 2001 UC | Disclaimer/Privacy