Basic Search | Intermediate Search | Advanced SQL Search | Gene Image Map |  Home

Chlamydia trachomatis

 Gene Flanking Sequence Viewer
This view is based on a particular gene which is displayed with some associated information above the sequence. You may add on "Flanking sequence" either upstream (Start Flank Size) or downstream (Stop Flank Size). You may specify the number of sequence characters per line and choose whether or not you want coordinates displayed to the right, left, or both left and right of the sequence. The sequence displayed is the sense strand relative to the gene the viewer is displaying. In reading the coordinates, note that there is no zero coordinate and that the genomic sequence is assumed to be circular.
Start Flank Size:
Stop Flank Size:
Characters per line:
Show Coordinates on: Left: Right:


Gene ID:CT363
Strand: Reverse Compliment
Gene Start: 415226
Gene Stop: 414225
Gene Length:   1002

415226  ATGACGATGCGCATTGCGATTTTAGGTGCTACAGGCCTTGTTGGACAAAA  415177
415176  GCTTATTGCTTTGTTACAAAATCATAAACAGTGGGAAATTGCTGAATTAG  415127
415126  GAGCTTCTTCTGAGAAGCATGCGTTGCGTTACGAATCTGCTTGTTTATGG  415077
415076  CAAGAGCCATTAATGGGGATGCCAGAGTCTGTTCGTGATTTATCTATTCG  415027
415026  CTCCGTTGAAGAGATAGAATCAAATATTGTTGTATCTTGTCTTCCTTCGT  414977
414976  CTGTTGCTTTTTCAGCAGAAACTACTTGTTTATCTTCGGGAAAGATAGTG  414927
414926  TTTTCTAATGCCACCGCCTATCGTATGCATAAAGCGGTTCCTATTTTAAT  414877
414876  TCCTGAGATAAACAGTGATCATTTGTCTCTGTTAGAAGAACAGCCTTTTT  414827
414826  TAGGTAAGATTATTACTAATTCTAATTGTTGTGTTTCAGGCATTGCTCTG  414777
414776  GCTCTTAAGCCACTGCTGTTGTTTAATATCGAGCATGTGCATGTTATCAC  414727
414726  TTTACAATCAGCTAGTGGGGCTGGATATCCTGGAGTTTCCTCTTTAGATT  414677
414676  TAATTGGAAACACTGTGCCTTATATCTTAGGAGAGGAAGAGAAGATACTC  414627
414626  CGAGAGACTGTAAAAATTTTAGGACAGCCAGGTTTTCCTGCAGAGTTTTC  414577
414576  TATAACTGCGTCTGTACATCGTGTTCCCGTTGCACATGGGCATGTCATCT  414527
414526  CTGTACACGTTATGTTTGATCAAGAGGTCGATTTAGAAGAGATAACTTCT  414477
414476  TGTTATGAGAAGGATTCGGCTACCTATGTTCTTTATGATTCTCCTTGGCA  414427
414426  TCCTCAGGTTCGAAAGGATCTAGCTCATGATGATATGCGATTACATATAG  414377
414376  GGCCCATTTCTTACGGCGGTAATACGCGAACTATTAAGATGTGTATCTTA  414327
414326  TTGCACAATTTGGTTCGAGGAGCTGCAGGAGCTTTGATAGCGAATATGAA  414277
414276  TCTTTTCCGAGATAGAGGAGGATTCGTTCATCAAGAGAGGCTGACGTATG  414227
414226  CT                                                  414225

Los Alamos National Laboratory     
Operated by the University of California for the National Nuclear Security Administration,
of the US Department of Energy.     Copyright © 2001 UC | Disclaimer/Privacy