Basic Search | Intermediate Search | Advanced SQL Search | Gene Image Map |  Home

Chlamydia trachomatis

 Gene Flanking Sequence Viewer
This view is based on a particular gene which is displayed with some associated information above the sequence. You may add on "Flanking sequence" either upstream (Start Flank Size) or downstream (Stop Flank Size). You may specify the number of sequence characters per line and choose whether or not you want coordinates displayed to the right, left, or both left and right of the sequence. The sequence displayed is the sense strand relative to the gene the viewer is displaying. In reading the coordinates, note that there is no zero coordinate and that the genomic sequence is assumed to be circular.
Start Flank Size:
Stop Flank Size:
Characters per line:
Show Coordinates on: Left: Right:


Gene ID:CT362
Strand: Reverse Compliment
Gene Start: 414229
Gene Stop: 412937
Gene Length:   1293

414229  ATGCTTAGACAAGAAACAGCTCCTCTTGTGTGTAAATTCGGTGGAACAAG  414180
414179  TGTGGGCACAGCCCAAAGTATTCGACGAGTTTGCGAGATTATACAAGAAG  414130
414129  AAAGACCTTCTTTTGTTGTTGTTAGCGCAGTAGCTGGTGTTACGGATTGG  414080
414079  TTAGAAGAGTTTTGTCGGCTTCCTAAAGGGAAGAGAGCGGCATTGACTGA  414030
414029  AAAGATTCGAGAAAGACATGAATCAATAGCAAAGGAATTAGGTATAGAGG  413980
413979  TTTCTCTAGCTATCTTTTGGGAGATCTTGGAACATTTTGAAGATGTAGAA  413930
413929  GAGCTTTTTTCTGAAGATCAAGCCAGGATTTTGGCTATAGGTGAGGATTT  413880
413879  ATCTTCGACTTTGATTTGTAGCTACTGCTGTACCTATGTGTTACCGCTTA  413830
413829  AGCGGTTAGAAGCTCGTCAAGTAATTCTCACCGACTCGCAATTTTTGCGG  413780
413779  GCGGTTCCAGATTTAGCTTTGATGCAAACTGCTTGGGGTGAGTTGGCATT  413730
413729  ACAAGAAGATACTATTTACCTTATGCAAGGCTTCCTTGGAGCAACGTCTT  413680
413679  CAGGGAAAACTACAGTTCTTGGTCGAGGGGGGAGTGACTTTTCTGCCTCT  413630
413629  CTGATAGGAGAACTGTGTAAAGCAAGAGAGTTGCGTATTTATACAGATGT  413580
413579  TTGTGGCGTGCATACTGCCGACCCAAAAATTTTGAAAGATACACAACTCA  413530
413529  TAGATTCTTTAACCTTTGAAGAGATGCAGGAGTTAGCAAGTTCTGGTGCT  413480
413479  AAGGTATTGCACCAAGATATGTTAAAGCCTTGTGTTCGAGCGAAGGTGCC  413430
413429  TATTTTTGTGACTTCAACATTTAATGTAACCAAAGAAGGGACTTGGATTT  413380
413379  GCGCTTCATTAAATGAGAGTACAGAGGGTCCTGTGATCAAAGCACTCTCA  413330
413329  TTGAAGTCGAATCAAGCTCTTTGGTTTGTAGAATACAATTCTCCTCTAGT  413280
413279  GAGACTAGAGGATGTTTTGGGTTGTGTACGAAGCTTGGGATTTGTTCCAG  413230
413229  GAGTTGTCATGGCTCAAAGTTTAGGAGTGTATTTCACTATAGATTGGGAA  413180
413179  GAGTATCCTCAGACTATAACAAAGGCTCTTGAAGCTTTTGGTACAGTAAG  413130
413129  TTGTGAGGGGCCTTTATCTTTAGTTGCATTAGTGGGAGCGAAGCTAGCTT  413080
413079  CATGGAGTATGTCTAGAGTCTTTGAGGCTCTACACAGAACTCCAGTTTTA  413030
413029  TGTTGGAGTCAAACGGATACGGTTATTAATTTAATTATTAATAAGGATTT  412980
412979  TGGGGTCGCTGTAACCGAGTTGTTGCACGATTGCCTATTTAAA         412937

Los Alamos National Laboratory     
Operated by the University of California for the National Nuclear Security Administration,
of the US Department of Energy.     Copyright © 2001 UC | Disclaimer/Privacy