Basic Search | Intermediate Search | Advanced SQL Search | Gene Image Map |  Home

Chlamydia trachomatis

 Gene Flanking Sequence Viewer
This view is based on a particular gene which is displayed with some associated information above the sequence. You may add on "Flanking sequence" either upstream (Start Flank Size) or downstream (Stop Flank Size). You may specify the number of sequence characters per line and choose whether or not you want coordinates displayed to the right, left, or both left and right of the sequence. The sequence displayed is the sense strand relative to the gene the viewer is displaying. In reading the coordinates, note that there is no zero coordinate and that the genomic sequence is assumed to be circular.
Start Flank Size:
Stop Flank Size:
Characters per line:
Show Coordinates on: Left: Right:


Gene ID:CT313
Strand: Reverse Compliment
Gene Start: 350375
Gene Stop: 349395
Gene Length:   981

350375  ATGTCTAGCCAGTTCGATCAGCTTAAGCTTTGGAGTGTTCTTGTTGGAGA  350326
350325  TACTGGAGATCCCGCTTTAATCAAGACGTTAGGGGTTCAGGATGCTACAA  350276
350275  CAAATCCTTCTTTGATCTTGAAGGTTGCTCAGGAGCCTAAGTACCAGTCG  350226
350225  ATGCTGACGGAAGCAATTTCTTGGGGCATCCGGCAGAATGGTGATGATGT  350176
350175  TCAAACTCTGACTTTTGTTTTAGATAAGATCCAAGTTAATTTAGGCTTGG  350126
350125  AGATTCTAAAGCATGTTCCTGGTCGGGTATCATTAGAAATTGATGCCCGG  350076
350075  CTTTCTTTTAATACAGAAGCAATGGTTCAGCGAGCGATTTTTTTATCTCA  350026
350025  ACTATTTGAGAAAATGGGAGGAGATAAGAAACGTTTATTAGTTAAAATTC  349976
349975  CTGGGACTTGGGAAGGTATCTGTGCTGCAGAGGTTTTAGAAAGCCAAGGG  349926
349925  ATTGCTTGTAACGTAACTTTAATTTTTAACCTTGTGCAAGCGATCGCAGC  349876
349875  AGCAAAAGCTAAAGTAACATTGGTCTCGCCTTTCGTTGGTCGGATTTATG  349826
349825  ATTGGTGGATCGCTGCTTATGGCGCAGAAGGGTATTCTATCGAAGCCGAT  349776
349775  CCTGGAGTTGCTTCCGTAGCAAATATCTATTCTTACTATAAGAAATTTGA  349726
349725  TATTCCGACTCAGATTATGGCGGCTTCTTTTAGAACGAAAGAGCAAGTGC  349676
349675  TTGCTTTAGCCGGATGTGATTTTTTAACAATTTCTCCTAAATTATTAGAA  349626
349625  GAACTCAAGAAAGATCAACAGCCTGTTGAAAGAAAGCTGAGCGTAGAAGA  349576
349575  AGCGAAAAAATTGGATATTCAACCTGTGGAGTTGTCAGAGAGCGTATTTC  349526
349525  GGTTCTTAATGAATGAAGATGCCATGGCAACAGAGAAGCTAGCTGAAGGT  349476
349475  ATTCGCATTTTTTCTGGTGACACTCAAATTTTAGAGTCTGCAGTTACCGA  349426
349425  ATTTATTAGACAGATCGCAGCCCAGGAAGCA                     349395

Los Alamos National Laboratory     
Operated by the University of California for the National Nuclear Security Administration,
of the US Department of Energy.     Copyright © 2001 UC | Disclaimer/Privacy