Basic Search | Intermediate Search | Advanced SQL Search | Gene Image Map |  Home

Chlamydia trachomatis

 Gene Flanking Sequence Viewer
This view is based on a particular gene which is displayed with some associated information above the sequence. You may add on "Flanking sequence" either upstream (Start Flank Size) or downstream (Stop Flank Size). You may specify the number of sequence characters per line and choose whether or not you want coordinates displayed to the right, left, or both left and right of the sequence. The sequence displayed is the sense strand relative to the gene the viewer is displaying. In reading the coordinates, note that there is no zero coordinate and that the genomic sequence is assumed to be circular.
Start Flank Size:
Stop Flank Size:
Characters per line:
Show Coordinates on: Left: Right:


Gene ID:CT245
Strand:Forward
Gene Start: 273563
Gene Stop: 274582
Gene Length:   1020

273563  ATGCATCCTCTGACTCTCAACATAGCTTCTGAGGAAACTACAGAAGCCCG  273612
273613  AGTTTTTCATGTTATTGAAAACTTCGGAAATTCTTTCTGCATTGACCTTT  273662
273663  TGAAAAAAATGCTACTCATTCGCGAATTTGAGATTCGCGGAGAAGAGGCC  273712
273713  TATTTAGAAGGCCTTGTTGGAGGATTTTATCACTCTTATATCGGTCAAGA  273762
273763  AGCTGTTGCTACAGCAGCTATTGCTTGCACAGGGAAAGACCACTGGTTTT  273812
273813  TTTCCTCTTATCGTTGTCACGGAGTAGCTCTGCTGCTGGATATCCCTTTA  273862
273863  CGACAACTGGCAGCAGAACTTCTAGGGAAAGAAACAGGGTGTGCTTTAGG  273912
273913  ACGAGGCGGATCTATGCATATGTGTGGTGATCGTCTTCCTGGAGGTTTTG  273962
273963  GTATCGTTGGTGGACAAATTCCTCTGGCTGCAGGTGCAGCATTTTCTATG  274012
274013  AAGTACCAAAACTCATCTTCTATATCTATGTGTTTTATTGGAGATGGAGC  274062
274063  TGTAGCTCAAGGAGTCTTTCATGAAACATTAAATTTTGTAGCGCTTCACT  274112
274113  CCCTTCCCTTAATGCTCATTATTGAAAACAATGGATGGAGTATGGGAACA  274162
274163  GCCTTACATAGAGCCATTGCTAAACAGCCTATAGCAGAATCCCAAGCGAT  274212
274213  TTCTTATGGTCTTTCTTCGATCACTTTGAATGGATTCGATTTATTTAATT  274262
274263  CGCTTATAGGATTTAGAGAAGCTTATCACCACATGCAACAAACAGGTTCT  274312
274313  CCTATTATCGTAGAGGCGCTATGTTCTCGATTTAGAGGACACTCTATTTC  274362
274363  CGATCCTAATTTATATCGCTCTAAAGAGGAAATGCAATGTCTTCTCAAAA  274412
274413  GAGATCCTATCCTTTTTGCAAAAGAATGGCTCATTCGTGCGAATGTCCTA  274462
274463  TCCGAAGATGATTTTAAAGATTTGCGTCAAACAAGCAAAACAGCTGTCCT  274512
274513  AGAAGCAGTCGCTCAAGCTCGTCTTGATCCAGAACCAGCTGTAGCTACTT  274562
274563  TAGAAGAGGGGGTCTATGCC                                274582

Los Alamos National Laboratory     
Operated by the University of California for the National Nuclear Security Administration,
of the US Department of Energy.     Copyright © 2001 UC | Disclaimer/Privacy