Basic Search | Intermediate Search | Advanced SQL Search | Gene Image Map |  Home

Chlamydia trachomatis

 Gene Flanking Sequence Viewer
This view is based on a particular gene which is displayed with some associated information above the sequence. You may add on "Flanking sequence" either upstream (Start Flank Size) or downstream (Stop Flank Size). You may specify the number of sequence characters per line and choose whether or not you want coordinates displayed to the right, left, or both left and right of the sequence. The sequence displayed is the sense strand relative to the gene the viewer is displaying. In reading the coordinates, note that there is no zero coordinate and that the genomic sequence is assumed to be circular.
Start Flank Size:
Stop Flank Size:
Characters per line:
Show Coordinates on: Left: Right:


Gene ID:CT123
Strand:Forward
Gene Start: 139400
Gene Stop: 139891
Gene Length:   492

139400  ATGGATTTAAAGCAGATAGAAAAGCTCATGATTGCTATGGGCCGTAATAA  139449
139450  AATGAAGCGCATTGTTATCAAGCGTGAAGGTTTGGAGTTAGAGTTAGAAA  139499
139500  GGGATACAGTCCCAAGTATTCAGGAGCCAGTCTTTTATGATAACAGACTG  139549
139550  TTTGCTGGATTTTCCCAAGAAAGACCTATTCCTACAGATCAAAACCTTGG  139599
139600  GAATCCTATTGTTAAAGAGAGTATCGAGAAGAAAGAAAGTGAGGCGCCTG  139649
139650  CTCAGGGAGATTTTATTGTTTCTCCGCTGGTAGGCACTTTTTATGGCTCT  139699
139700  CCTTCGCCAGAGGCTCCAGCATTTATTAAGCCTGGGGATACTGTTTCAGA  139749
139750  GGATACCGTTGTTTGTATCGTGGAAGCTATGAAGGTAATGAACGAGGTAA  139799
139800  AGGCAGGAATGTCTGGTCGCGTAGAAGAAATATTGATTACTAATGGTGAT  139849
139850  CCAGTCCAGTTTGGTTCTAAGTTATTCCGTATAGTTAAGGCT          139891

Los Alamos National Laboratory     
Operated by the University of California for the National Nuclear Security Administration,
of the US Department of Energy.     Copyright © 2001 UC | Disclaimer/Privacy